Incidental Mutation 'R6705:Wdr27'
ID528920
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14934590 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 22 (Y22N)
Ref Sequence ENSEMBL: ENSMUSP00000155992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170386
AA Change: Y22N

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: Y22N

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228221
Predicted Effect possibly damaging
Transcript: ENSMUST00000228330
AA Change: Y22N

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228869
Predicted Effect probably damaging
Transcript: ENSMUST00000232147
AA Change: Y22N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.3339 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCACAGGTGACTCCATGAG -3'
(R):5'- TACACTCATGCTCATGGTGATG -3'

Sequencing Primer
(F):5'- CTCCATGAGAGGGAATGTTTCTAG -3'
(R):5'- CCGTGTATTGCACATGGT -3'
Posted On2018-07-24