Incidental Mutation 'R6705:Kdm3b'
ID 528922
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene Name KDM3B lysine (K)-specific demethylase 3B
Synonyms JHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R6705 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34777047-34838660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34819873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 899 (I899V)
Ref Sequence ENSEMBL: ENSMUSP00000153446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000225195]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: I1099V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: I1099V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224065
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: I899V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
Affable UTSW 18 34793005 missense probably damaging 1.00
Dotage UTSW 18 34827382 missense probably damaging 1.00
Endearing UTSW 18 34827328 splice site probably null
Oldtimer UTSW 18 34823699 nonsense probably null
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1558:Kdm3b UTSW 18 34809096 missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R2281:Kdm3b UTSW 18 34808419 missense probably damaging 1.00
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34828469 missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
R7488:Kdm3b UTSW 18 34824881 missense probably damaging 0.97
R7587:Kdm3b UTSW 18 34797027 splice site probably null
R7695:Kdm3b UTSW 18 34794559 missense possibly damaging 0.86
R7846:Kdm3b UTSW 18 34809240 missense possibly damaging 0.94
R7984:Kdm3b UTSW 18 34823699 nonsense probably null
R7997:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R8035:Kdm3b UTSW 18 34808728 missense probably damaging 1.00
R8064:Kdm3b UTSW 18 34813407 critical splice acceptor site probably null
R8141:Kdm3b UTSW 18 34828546 nonsense probably null
R8302:Kdm3b UTSW 18 34834335 missense probably damaging 1.00
R8328:Kdm3b UTSW 18 34793070 missense probably damaging 1.00
R8443:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8513:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8515:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8523:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8717:Kdm3b UTSW 18 34819787 missense probably damaging 0.98
R8725:Kdm3b UTSW 18 34827382 missense probably damaging 1.00
R8727:Kdm3b UTSW 18 34827382 missense probably damaging 1.00
R8762:Kdm3b UTSW 18 34804104 missense probably benign
R8835:Kdm3b UTSW 18 34808749 missense probably damaging 1.00
R8918:Kdm3b UTSW 18 34837597 missense probably damaging 1.00
R9015:Kdm3b UTSW 18 34830159 missense probably damaging 1.00
R9144:Kdm3b UTSW 18 34794505 missense probably benign
R9246:Kdm3b UTSW 18 34808427 nonsense probably null
R9376:Kdm3b UTSW 18 34837665 missense probably damaging 0.99
X0028:Kdm3b UTSW 18 34799266 splice site probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Z1176:Kdm3b UTSW 18 34809069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCATGAGAAAATTTGCG -3'
(R):5'- CCTGTCTCAAACATGTGTGTACACC -3'

Sequencing Primer
(F):5'- GCGGTTCTAAAACTTCTCACTGAGAG -3'
(R):5'- ATGTGTGTACACCCCCACC -3'
Posted On 2018-07-24