Incidental Mutation 'R6706:Olfr1260'
ID528929
Institutional Source Beutler Lab
Gene Symbol Olfr1260
Ensembl Gene ENSMUSG00000042894
Gene Nameolfactory receptor 1260
SynonymsGA_x6K02T2Q125-51409740-51410672, MOR232-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89974340-89981586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89978585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 269 (V269E)
Ref Sequence ENSEMBL: ENSMUSP00000107137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061830] [ENSMUST00000111512] [ENSMUST00000144710] [ENSMUST00000214630] [ENSMUST00000216678]
Predicted Effect probably damaging
Transcript: ENSMUST00000061830
AA Change: V269E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053523
Gene: ENSMUSG00000042894
AA Change: V269E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.7e-45 PFAM
Pfam:7tm_1 39 285 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111512
AA Change: V269E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107137
Gene: ENSMUSG00000042894
AA Change: V269E

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 7.4e-27 PFAM
Pfam:7tm_4 137 278 2.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144613
Predicted Effect probably benign
Transcript: ENSMUST00000144710
SMART Domains Protein: ENSMUSP00000119512
Gene: ENSMUSG00000042894

DomainStartEndE-ValueType
Pfam:7tm_1 39 121 4.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213162
Predicted Effect probably benign
Transcript: ENSMUST00000214630
Predicted Effect probably benign
Transcript: ENSMUST00000216678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216744
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Olfr1260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1260 APN 2 89978539 missense possibly damaging 0.69
IGL01657:Olfr1260 APN 2 89977877 missense probably damaging 1.00
IGL01942:Olfr1260 APN 2 89977978 missense probably benign 0.03
IGL02139:Olfr1260 APN 2 89978429 missense possibly damaging 0.80
IGL02926:Olfr1260 APN 2 89978162 missense probably damaging 1.00
IGL03110:Olfr1260 APN 2 89978149 missense probably damaging 1.00
IGL03368:Olfr1260 APN 2 89977789 missense probably benign
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0087:Olfr1260 UTSW 2 89978131 missense probably damaging 1.00
R0599:Olfr1260 UTSW 2 89978201 missense probably benign 0.01
R1208:Olfr1260 UTSW 2 89978492 missense probably damaging 0.99
R1208:Olfr1260 UTSW 2 89978492 missense probably damaging 0.99
R1424:Olfr1260 UTSW 2 89978071 nonsense probably null
R1503:Olfr1260 UTSW 2 89978528 missense probably damaging 0.99
R1708:Olfr1260 UTSW 2 89978038 missense probably benign 0.00
R1863:Olfr1260 UTSW 2 89978410 missense probably benign 0.02
R1866:Olfr1260 UTSW 2 89978327 missense probably damaging 1.00
R2072:Olfr1260 UTSW 2 89978213 missense probably benign 0.04
R2219:Olfr1260 UTSW 2 89977912 missense possibly damaging 0.62
R4606:Olfr1260 UTSW 2 89978006 missense possibly damaging 0.79
R4674:Olfr1260 UTSW 2 89977906 missense possibly damaging 0.52
R4825:Olfr1260 UTSW 2 89978153 missense probably damaging 1.00
R5822:Olfr1260 UTSW 2 89978443 missense probably damaging 1.00
R6487:Olfr1260 UTSW 2 89977838 missense probably benign 0.31
X0050:Olfr1260 UTSW 2 89978016 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAACCACATCTTTGGACTCTTTG -3'
(R):5'- CATGAGTCACACTTGGAAAACAG -3'

Sequencing Primer
(F):5'- CCAACAGCGGGCTAATGTGTATG -3'
(R):5'- TGAGTCACACTTGGAAAACAGAAAAG -3'
Posted On2018-07-24