Incidental Mutation 'R6706:Plin2'
List |< first << previous [record 30 of 39] next >> last >|
ID528935
Institutional Source Beutler Lab
Gene Symbol Plin2
Ensembl Gene ENSMUSG00000028494
Gene Nameperilipin 2
Synonymsadipophilin, Adrp, Adfp, ADPH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86648386-86670060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86660120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 247 (T247A)
Ref Sequence ENSEMBL: ENSMUSP00000000466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]
Predicted Effect probably benign
Transcript: ENSMUST00000000466
AA Change: T247A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: T247A

DomainStartEndE-ValueType
Pfam:Perilipin 6 393 5.3e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138605
Predicted Effect probably benign
Transcript: ENSMUST00000140382
SMART Domains Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147097
SMART Domains Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 157 3.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149700
SMART Domains Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154999
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Plin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Plin2 APN 4 86664446 missense possibly damaging 0.88
IGL02501:Plin2 APN 4 86664486 nonsense probably null
IGL02551:Plin2 APN 4 86658692 missense probably benign 0.00
IGL03294:Plin2 APN 4 86662078 missense probably damaging 0.96
R1484:Plin2 UTSW 4 86657244 missense probably benign 0.00
R2165:Plin2 UTSW 4 86668432 missense probably damaging 1.00
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2873:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R3125:Plin2 UTSW 4 86657144 nonsense probably null
R4948:Plin2 UTSW 4 86661991 missense probably benign 0.00
R5189:Plin2 UTSW 4 86657146 missense probably damaging 1.00
R5563:Plin2 UTSW 4 86662104 missense probably benign 0.01
R6229:Plin2 UTSW 4 86668666 missense probably benign
R6258:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6260:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6391:Plin2 UTSW 4 86661999 missense probably null 0.99
R6470:Plin2 UTSW 4 86668370 missense probably damaging 1.00
R6493:Plin2 UTSW 4 86661987 missense possibly damaging 0.80
R6562:Plin2 UTSW 4 86658595 missense probably benign 0.07
R7310:Plin2 UTSW 4 86668391 missense probably benign 0.03
U24488:Plin2 UTSW 4 86662077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGCCCAGGAGGTCTAC -3'
(R):5'- ACTGTGGAATCCTGAACAAAGG -3'

Sequencing Primer
(F):5'- GCCCAGGAGGTCTACTTTTATTTTC -3'
(R):5'- AGGATCACCTTTGCTTATTTTCTC -3'
Posted On2018-07-24