Mutagenetix > Incidental Mutation

Incidental Mutation 'R6706:Map3k6'

528936

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R6706 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 133250939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1031 (K1031*)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030674

SMART Domains

Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	169	183	N/A	INTRINSIC
low complexity region	235	262	N/A	INTRINSIC
C2	288	389	2.36e-17	SMART
C2	429	532	6.96e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000030677
AA Change: K1031*

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: K1031*

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105908

SMART Domains

Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	157	171	N/A	INTRINSIC
low complexity region	223	250	N/A	INTRINSIC
C2	276	359	3.15e-4	SMART
C2	364	467	6.96e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154911

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	A	8: 43,651,442	K389*	probably null	Het
Adam6a	T	G	12: 113,545,266	F420V	probably benign	Het
Alpl	T	C	4: 137,746,429	T321A	probably benign	Het
Asxl3	A	G	18: 22,453,609	D152G	probably damaging	Het
B4galt4	A	G	16: 38,757,811	T207A	probably benign	Het
Bsph2	A	T	7: 13,571,047	M1K	probably null	Het
Cacna2d1	T	A	5: 16,326,340	L535Q	probably damaging	Het
Cacna2d3	T	C	14: 29,124,685		probably null	Het
Chrdl2	T	C	7: 100,010,121		probably null	Het
Ctdnep1	A	G	11: 69,984,312	N54S	probably benign	Het
Dclre1a	A	T	19: 56,545,069	D364E	probably benign	Het
Dock1	A	G	7: 135,133,886	I1328V	possibly damaging	Het
Eno4	A	T	19: 58,970,680	E411D	probably benign	Het
Fbxl14	A	G	6: 119,480,755	Y299C	probably benign	Het
Fhdc1	T	C	3: 84,446,422	S499G	probably damaging	Het
Hectd4	C	T	5: 121,320,084	T771I	possibly damaging	Het
Kansl3	A	G	1: 36,344,914		probably null	Het
Letm2	G	A	8: 25,593,961	H85Y	probably benign	Het
Mfsd4b5	T	A	10: 39,986,417	T37S	probably benign	Het
Mgam	T	A	6: 40,744,786	V346D	probably benign	Het
Myrip	C	T	9: 120,388,293	H98Y	possibly damaging	Het
Nos2	A	G	11: 78,944,723	N443D	possibly damaging	Het
Notch2	A	T	3: 98,138,430	D1637V	possibly damaging	Het
Olfr1260	T	A	2: 89,978,585	V269E	probably damaging	Het
Olfr1347	G	A	7: 6,488,050	R275C	probably damaging	Het
Pank1	C	T	19: 34,812,386	G530D	probably damaging	Het
Pde4dip	G	T	3: 97,741,393	R1036S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Plin2	T	C	4: 86,660,120	T247A	probably benign	Het
Rp1	T	A	1: 4,142,664	I1067F	unknown	Het
Serpinb9d	T	A	13: 33,196,558	N142K	probably benign	Het
Slc12a5	A	G	2: 164,988,589	Y639C	probably damaging	Het
Tfap2c	A	G	2: 172,557,356	M508V	probably benign	Het
Tmprss11d	T	C	5: 86,331,103	N147S	probably benign	Het
Togaram1	T	A	12: 65,002,609	N1273K	probably benign	Het
Ttn	G	A	2: 76,879,343	R1581*	probably null	Het
Uggt2	T	A	14: 119,070,881	I363F	probably damaging	Het
Vmn2r63	T	A	7: 42,928,577	D179V	probably damaging	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGCCCACACTAGCAGAGAATC -3'
(R):5'- CTGGAACATCAAGATCTTGCTCG -3'

Sequencing Primer
(F):5'- CACTAGCAGAGAATCTCCTGG -3'
(R):5'- TTGCATAGCCCTAACTTCGAGATAGC -3'

Posted On

2018-07-24