Incidental Mutation 'R6706:Mgam'
ID 528942
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission 044824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R6706 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40721720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 346 (V346D)
Ref Sequence ENSEMBL: ENSMUSP00000144627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202775
Predicted Effect probably benign
Transcript: ENSMUST00000202779
AA Change: V346D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: V346D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
AA Change: V227D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: V227D

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 44,104,479 (GRCm39) K389* probably null Het
Adam6a T G 12: 113,508,886 (GRCm39) F420V probably benign Het
Alpl T C 4: 137,473,740 (GRCm39) T321A probably benign Het
Asxl3 A G 18: 22,586,666 (GRCm39) D152G probably damaging Het
B4galt4 A G 16: 38,578,173 (GRCm39) T207A probably benign Het
Bsph2 A T 7: 13,304,972 (GRCm39) M1K probably null Het
Cacna2d1 T A 5: 16,531,338 (GRCm39) L535Q probably damaging Het
Cacna2d3 T C 14: 28,846,642 (GRCm39) probably null Het
Chrdl2 T C 7: 99,659,328 (GRCm39) probably null Het
Ctdnep1 A G 11: 69,875,138 (GRCm39) N54S probably benign Het
Dclre1a A T 19: 56,533,501 (GRCm39) D364E probably benign Het
Dock1 A G 7: 134,735,615 (GRCm39) I1328V possibly damaging Het
Eno4 A T 19: 58,959,112 (GRCm39) E411D probably benign Het
Fbxl14 A G 6: 119,457,716 (GRCm39) Y299C probably benign Het
Fhdc1 T C 3: 84,353,729 (GRCm39) S499G probably damaging Het
Hectd4 C T 5: 121,458,147 (GRCm39) T771I possibly damaging Het
Kansl3 A G 1: 36,383,995 (GRCm39) probably null Het
Letm2 G A 8: 26,083,977 (GRCm39) H85Y probably benign Het
Map3k6 A T 4: 132,978,250 (GRCm39) K1031* probably null Het
Mfsd4b5 T A 10: 39,862,413 (GRCm39) T37S probably benign Het
Myrip C T 9: 120,217,359 (GRCm39) H98Y possibly damaging Het
Nos2 A G 11: 78,835,549 (GRCm39) N443D possibly damaging Het
Notch2 A T 3: 98,045,746 (GRCm39) D1637V possibly damaging Het
Or4c35 T A 2: 89,808,929 (GRCm39) V269E probably damaging Het
Or6z6 G A 7: 6,491,049 (GRCm39) R275C probably damaging Het
Pank1 C T 19: 34,789,786 (GRCm39) G530D probably damaging Het
Pde4dip G T 3: 97,648,709 (GRCm39) R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Plin2 T C 4: 86,578,357 (GRCm39) T247A probably benign Het
Rp1 T A 1: 4,212,887 (GRCm39) I1067F unknown Het
Serpinb9d T A 13: 33,380,541 (GRCm39) N142K probably benign Het
Slc12a5 A G 2: 164,830,509 (GRCm39) Y639C probably damaging Het
Tfap2c A G 2: 172,399,276 (GRCm39) M508V probably benign Het
Tmprss11d T C 5: 86,478,962 (GRCm39) N147S probably benign Het
Togaram1 T A 12: 65,049,383 (GRCm39) N1273K probably benign Het
Ttn G A 2: 76,709,687 (GRCm39) R1581* probably null Het
Uggt2 T A 14: 119,308,293 (GRCm39) I363F probably damaging Het
Vmn2r63 T A 7: 42,578,001 (GRCm39) D179V probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB002:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1872:Mgam UTSW 6 40,638,234 (GRCm39) nonsense probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2224:Mgam UTSW 6 40,741,208 (GRCm39) splice site probably null
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9287:Mgam UTSW 6 40,705,905 (GRCm39) intron probably benign
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGGGCATAGGACTGGG -3'
(R):5'- AGGTTCTGTCCACACCTGGTAG -3'

Sequencing Primer
(F):5'- AAGTACATTTCTTGAAGAGTGCGCAC -3'
(R):5'- TGTCCACACCTGGTAGCACAC -3'
Posted On 2018-07-24