Incidental Mutation 'R6706:Fbxl14'
ID528943
Institutional Source Beutler Lab
Gene Symbol Fbxl14
Ensembl Gene ENSMUSG00000030019
Gene NameF-box and leucine-rich repeat protein 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119479668-119482630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119480755 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 299 (Y299C)
Ref Sequence ENSEMBL: ENSMUSP00000032094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032094] [ENSMUST00000119369] [ENSMUST00000178696]
Predicted Effect probably benign
Transcript: ENSMUST00000032094
AA Change: Y299C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032094
Gene: ENSMUSG00000030019
AA Change: Y299C

DomainStartEndE-ValueType
FBOX 8 48 6.86e-3 SMART
LRR 89 114 6.04e0 SMART
LRR 116 141 5.42e-2 SMART
LRR 142 167 6.88e0 SMART
LRR 168 193 2.49e-1 SMART
LRR 201 226 2.14e0 SMART
LRR 227 252 1.08e-1 SMART
LRR 253 277 2.71e-2 SMART
LRR 278 303 5.72e-1 SMART
LRR 304 328 5.74e1 SMART
LRR 329 354 2.24e-3 SMART
LRR 355 380 2.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119369
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178696
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL14, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Fbxl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0382:Fbxl14 UTSW 6 119481060 makesense probably null
R0699:Fbxl14 UTSW 6 119480754 missense probably benign
R1328:Fbxl14 UTSW 6 119480386 missense possibly damaging 0.95
R1696:Fbxl14 UTSW 6 119480146 missense probably damaging 1.00
R4928:Fbxl14 UTSW 6 119480710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTGAAGCACATCTCGC -3'
(R):5'- ACAGATCTATGCCCGTGAGC -3'

Sequencing Primer
(F):5'- TGAAGCACATCTCGCGAGGG -3'
(R):5'- TGAGCTGGCTCAGGTGCTC -3'
Posted On2018-07-24