Mutagenetix > Incidental Mutations

Incidental Mutation 'R6706:Vmn2r63'

528946

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r63

Ensembl Gene

ENSMUSG00000090751

Gene Name

vomeronasal 2, receptor 63

Synonyms

EG435975

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R6706 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42903251-42933789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42928577 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 179 (D179V)

Ref Sequence

ENSEMBL: ENSMUSP00000129089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163803]

Predicted Effect

probably damaging
Transcript: ENSMUST00000163803
AA Change: D179V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: D179V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	471	3.5e-43	PFAM
Pfam:NCD3G	514	567	5.1e-23	PFAM
Pfam:7tm_3	600	835	3.5e-51	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

97% (36/37)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	A	8: 43,651,442	K389*	probably null	Het
Adam6a	T	G	12: 113,545,266	F420V	probably benign	Het
Alpl	T	C	4: 137,746,429	T321A	probably benign	Het
Asxl3	A	G	18: 22,453,609	D152G	probably damaging	Het
B4galt4	A	G	16: 38,757,811	T207A	probably benign	Het
Bsph2	A	T	7: 13,571,047	M1K	probably null	Het
Cacna2d1	T	A	5: 16,326,340	L535Q	probably damaging	Het
Cacna2d3	T	C	14: 29,124,685		probably null	Het
Chrdl2	T	C	7: 100,010,121		probably null	Het
Ctdnep1	A	G	11: 69,984,312	N54S	probably benign	Het
Dclre1a	A	T	19: 56,545,069	D364E	probably benign	Het
Dock1	A	G	7: 135,133,886	I1328V	possibly damaging	Het
Eno4	A	T	19: 58,970,680	E411D	probably benign	Het
Fbxl14	A	G	6: 119,480,755	Y299C	probably benign	Het
Fhdc1	T	C	3: 84,446,422	S499G	probably damaging	Het
Hectd4	C	T	5: 121,320,084	T771I	possibly damaging	Het
Kansl3	A	G	1: 36,344,914		probably null	Het
Letm2	G	A	8: 25,593,961	H85Y	probably benign	Het
Map3k6	A	T	4: 133,250,939	K1031*	probably null	Het
Mfsd4b5	T	A	10: 39,986,417	T37S	probably benign	Het
Mgam	T	A	6: 40,744,786	V346D	probably benign	Het
Myrip	C	T	9: 120,388,293	H98Y	possibly damaging	Het
Nos2	A	G	11: 78,944,723	N443D	possibly damaging	Het
Notch2	A	T	3: 98,138,430	D1637V	possibly damaging	Het
Olfr1260	T	A	2: 89,978,585	V269E	probably damaging	Het
Olfr1347	G	A	7: 6,488,050	R275C	probably damaging	Het
Pank1	C	T	19: 34,812,386	G530D	probably damaging	Het
Pde4dip	G	T	3: 97,741,393	R1036S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Plin2	T	C	4: 86,660,120	T247A	probably benign	Het
Rp1	T	A	1: 4,142,664	I1067F	unknown	Het
Serpinb9d	T	A	13: 33,196,558	N142K	probably benign	Het
Slc12a5	A	G	2: 164,988,589	Y639C	probably damaging	Het
Tfap2c	A	G	2: 172,557,356	M508V	probably benign	Het
Tmprss11d	T	C	5: 86,331,103	N147S	probably benign	Het
Togaram1	T	A	12: 65,002,609	N1273K	probably benign	Het
Ttn	G	A	2: 76,879,343	R1581*	probably null	Het
Uggt2	T	A	14: 119,070,881	I363F	probably damaging	Het

Other mutations in Vmn2r63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Vmn2r63	APN	7	42904119	missense	probably damaging	0.99
IGL01765:Vmn2r63	APN	7	42903364	missense	probably benign
IGL02203:Vmn2r63	APN	7	42904008	missense	probably benign	0.01
IGL02825:Vmn2r63	APN	7	42926850	critical splice donor site	probably null
IGL03155:Vmn2r63	APN	7	42903454	missense	probably damaging	1.00
IGL03260:Vmn2r63	APN	7	42929192	missense	probably damaging	1.00
IGL03411:Vmn2r63	APN	7	42927944	missense	probably benign	0.42
PIT4280001:Vmn2r63	UTSW	7	42903985	missense	probably damaging	1.00
R0066:Vmn2r63	UTSW	7	42927090	splice site	probably benign
R0328:Vmn2r63	UTSW	7	42903275	missense	probably benign	0.09
R0344:Vmn2r63	UTSW	7	42903618	missense	probably damaging	0.98
R0554:Vmn2r63	UTSW	7	42933705	nonsense	probably null
R0555:Vmn2r63	UTSW	7	42928528	nonsense	probably null
R0685:Vmn2r63	UTSW	7	42928010	missense	probably benign	0.13
R0751:Vmn2r63	UTSW	7	42928035	missense	probably damaging	1.00
R1349:Vmn2r63	UTSW	7	42929218	missense	possibly damaging	0.95
R1372:Vmn2r63	UTSW	7	42929218	missense	possibly damaging	0.95
R1416:Vmn2r63	UTSW	7	42927915	missense	probably benign	0.00
R1502:Vmn2r63	UTSW	7	42928591	missense	possibly damaging	0.62
R1563:Vmn2r63	UTSW	7	42904126	missense	probably benign	0.00
R1652:Vmn2r63	UTSW	7	42928211	missense	probably benign	0.32
R1693:Vmn2r63	UTSW	7	42928319	missense	probably benign
R1698:Vmn2r63	UTSW	7	42933614	missense	probably benign
R1753:Vmn2r63	UTSW	7	42928245	nonsense	probably null
R2136:Vmn2r63	UTSW	7	42926873	missense	probably damaging	0.99
R2175:Vmn2r63	UTSW	7	42933580	critical splice donor site	probably null
R2261:Vmn2r63	UTSW	7	42928607	missense	probably benign	0.02
R2262:Vmn2r63	UTSW	7	42928607	missense	probably benign	0.02
R2263:Vmn2r63	UTSW	7	42928607	missense	probably benign	0.02
R3413:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R3426:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R3427:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R3802:Vmn2r63	UTSW	7	42903405	missense	probably damaging	0.99
R4319:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R4321:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R4323:Vmn2r63	UTSW	7	42926982	missense	probably benign	0.04
R4346:Vmn2r63	UTSW	7	42928113	missense	possibly damaging	0.67
R4568:Vmn2r63	UTSW	7	42933826	splice site	probably null
R4649:Vmn2r63	UTSW	7	42903690	missense	possibly damaging	0.79
R4653:Vmn2r63	UTSW	7	42903690	missense	possibly damaging	0.79
R4679:Vmn2r63	UTSW	7	42928120	missense	probably benign	0.00
R4734:Vmn2r63	UTSW	7	42928120	missense	probably benign	0.00
R4741:Vmn2r63	UTSW	7	42928120	missense	probably benign	0.00
R4748:Vmn2r63	UTSW	7	42928120	missense	probably benign	0.00
R4806:Vmn2r63	UTSW	7	42926890	missense	probably benign	0.34
R4933:Vmn2r63	UTSW	7	42903978	missense	probably damaging	1.00
R5198:Vmn2r63	UTSW	7	42903745	missense	probably benign	0.01
R5399:Vmn2r63	UTSW	7	42928277	missense	probably benign
R5400:Vmn2r63	UTSW	7	42928211	missense	probably benign	0.32
R6158:Vmn2r63	UTSW	7	42933680	missense	probably damaging	1.00
R6185:Vmn2r63	UTSW	7	42929011	missense	probably damaging	0.98
R6267:Vmn2r63	UTSW	7	42928635	splice site	probably null
R6362:Vmn2r63	UTSW	7	42903297	missense	probably benign
R6764:Vmn2r63	UTSW	7	42903271	missense	probably damaging	0.97
R7104:Vmn2r63	UTSW	7	42928535	missense	possibly damaging	0.67
R7503:Vmn2r63	UTSW	7	42933590	missense	probably benign	0.02
R7506:Vmn2r63	UTSW	7	42926967	missense	probably damaging	1.00
R7525:Vmn2r63	UTSW	7	42926982	missense	possibly damaging	0.52
R7658:Vmn2r63	UTSW	7	42925269	missense	probably damaging	1.00
R7663:Vmn2r63	UTSW	7	42927042	missense	probably benign	0.00
R7702:Vmn2r63	UTSW	7	42928129	missense	possibly damaging	0.46
R7918:Vmn2r63	UTSW	7	42903531	missense	probably damaging	1.00
Z1088:Vmn2r63	UTSW	7	42928559	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGTGCCAGGAATCATTTTCAC -3'
(R):5'- ACTTGATGACAGATCCACAATTCC -3'

Sequencing Primer
(F):5'- GTGCCAGGAATCATTTTCACAAAGG -3'
(R):5'- TGATGACAGATCCACAATTCCATTAC -3'

Posted On

2018-07-24