Incidental Mutation 'R6706:Chrdl2'
ID528947
Institutional Source Beutler Lab
Gene Symbol Chrdl2
Ensembl Gene ENSMUSG00000030732
Gene Namechordin-like 2
Synonyms1810022C01Rik, Chl2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100006172-100034728 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 100010121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]
Predicted Effect probably benign
Transcript: ENSMUST00000032977
SMART Domains Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 33 95 1.13e-3 SMART
VWC 111 174 1.58e-1 SMART
low complexity region 207 219 N/A INTRINSIC
VWC 248 310 3.09e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107084
SMART Domains Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732

DomainStartEndE-ValueType
VWC 40 102 1.13e-3 SMART
VWC 118 181 1.58e-1 SMART
low complexity region 214 226 N/A INTRINSIC
VWC 255 317 3.09e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207641
Meta Mutation Damage Score 0.6808 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Chrdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chrdl2 APN 7 100034641 missense probably damaging 0.96
IGL00965:Chrdl2 APN 7 100006653 splice site probably null
IGL01320:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01322:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01977:Chrdl2 APN 7 100022056 missense probably benign 0.33
IGL02170:Chrdl2 APN 7 100034614 missense possibly damaging 0.92
IGL02478:Chrdl2 APN 7 100020983 critical splice donor site probably null
IGL02745:Chrdl2 APN 7 100020963 missense probably damaging 1.00
IGL03117:Chrdl2 APN 7 100027580 missense possibly damaging 0.83
IGL03377:Chrdl2 APN 7 100022052 missense probably benign 0.03
Measley UTSW 7 100010121 critical splice donor site probably null
R1453:Chrdl2 UTSW 7 100016990 missense possibly damaging 0.64
R1900:Chrdl2 UTSW 7 100033664 missense possibly damaging 0.75
R2092:Chrdl2 UTSW 7 100020977 nonsense probably null
R3421:Chrdl2 UTSW 7 100023868 missense probably damaging 1.00
R3949:Chrdl2 UTSW 7 100029205 missense possibly damaging 0.89
R4305:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4306:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4776:Chrdl2 UTSW 7 100006541 unclassified probably benign
R5208:Chrdl2 UTSW 7 100023922 missense probably damaging 0.96
R5327:Chrdl2 UTSW 7 100028741 missense probably damaging 1.00
R5859:Chrdl2 UTSW 7 100020907 missense probably damaging 1.00
R5928:Chrdl2 UTSW 7 100009993 start gained probably benign
R7027:Chrdl2 UTSW 7 100022033 missense probably damaging 1.00
R7039:Chrdl2 UTSW 7 100028672 missense probably damaging 1.00
R7357:Chrdl2 UTSW 7 100029207 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTGCACCTGTTCAG -3'
(R):5'- AGTTATGAACTCAGACCATATCCAG -3'

Sequencing Primer
(F):5'- TGCACCTGTTCAGGGCTG -3'
(R):5'- GTCCCTTTACTCTAGAAAAAGAGAGC -3'
Posted On2018-07-24