Incidental Mutation 'R6706:Letm2'
ID528949
Institutional Source Beutler Lab
Gene Symbol Letm2
Ensembl Gene ENSMUSG00000037363
Gene Nameleucine zipper-EF-hand containing transmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25578490-25597582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25593961 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 85 (H85Y)
Ref Sequence ENSEMBL: ENSMUSP00000147648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079160] [ENSMUST00000210234] [ENSMUST00000210616] [ENSMUST00000210810] [ENSMUST00000211422]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059474
Predicted Effect probably benign
Transcript: ENSMUST00000079160
AA Change: H85Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078160
Gene: ENSMUSG00000037363
AA Change: H85Y

DomainStartEndE-ValueType
low complexity region 106 117 N/A INTRINSIC
Pfam:LETM1 120 384 1.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210221
Predicted Effect probably benign
Transcript: ENSMUST00000210234
AA Change: H85Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210582
Predicted Effect probably benign
Transcript: ENSMUST00000210616
AA Change: H85Y

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210810
AA Change: H85Y

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211137
Predicted Effect probably benign
Transcript: ENSMUST00000211422
AA Change: H85Y

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Letm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Letm2 APN 8 25586773 missense probably damaging 1.00
selbstlob UTSW 8 25593961 missense probably benign 0.03
IGL03098:Letm2 UTSW 8 25581729 missense possibly damaging 0.73
R0062:Letm2 UTSW 8 25587448 splice site probably benign
R0062:Letm2 UTSW 8 25587448 splice site probably benign
R0207:Letm2 UTSW 8 25578770 missense probably damaging 0.96
R0485:Letm2 UTSW 8 25592558 missense probably damaging 1.00
R1869:Letm2 UTSW 8 25581713 missense probably damaging 0.98
R1870:Letm2 UTSW 8 25596444 splice site probably benign
R1871:Letm2 UTSW 8 25596444 splice site probably benign
R3881:Letm2 UTSW 8 25593868 nonsense probably null
R4115:Letm2 UTSW 8 25580327 nonsense probably null
R4459:Letm2 UTSW 8 25586699 missense probably damaging 1.00
R4461:Letm2 UTSW 8 25586699 missense probably damaging 1.00
R4961:Letm2 UTSW 8 25594092 missense possibly damaging 0.86
R5063:Letm2 UTSW 8 25581779 missense probably benign 0.26
R5069:Letm2 UTSW 8 25593964 nonsense probably null
R5732:Letm2 UTSW 8 25587325 missense possibly damaging 0.51
R6527:Letm2 UTSW 8 25592506 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTAGCCTCCACACTATTCTGGC -3'
(R):5'- TGCCTGGCCATTCTGTGTAC -3'

Sequencing Primer
(F):5'- GCAGCGACTTTGGTGTCAATCC -3'
(R):5'- GGCCATTCTGTGTACCCTTC -3'
Posted On2018-07-24