Incidental Mutation 'R6706:Ctdnep1'
ID528952
Institutional Source Beutler Lab
Gene Symbol Ctdnep1
Ensembl Gene ENSMUSG00000018559
Gene NameCTD nuclear envelope phosphatase 1
Synonyms2610507E10Rik, Dullard
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69981156-69990601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69984312 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 54 (N54S)
Ref Sequence ENSEMBL: ENSMUSP00000104234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108593] [ENSMUST00000108594] [ENSMUST00000108595] [ENSMUST00000141623] [ENSMUST00000142788] [ENSMUST00000143175] [ENSMUST00000147437]
Predicted Effect probably benign
Transcript: ENSMUST00000108593
AA Change: N54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104234
Gene: ENSMUSG00000018559
AA Change: N54S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
CPDc 60 212 7.35e-76 SMART
low complexity region 214 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108594
SMART Domains Protein: ENSMUSP00000104235
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 201 1.1e-12 PFAM
Pfam:Elong_Iki1 205 282 3.8e-10 PFAM
low complexity region 283 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108595
SMART Domains Protein: ENSMUSP00000104236
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 139 9.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123701
Predicted Effect probably benign
Transcript: ENSMUST00000127437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138562
Predicted Effect probably benign
Transcript: ENSMUST00000141623
SMART Domains Protein: ENSMUSP00000137199
Gene: ENSMUSG00000018559

DomainStartEndE-ValueType
CPDc 1 79 6.29e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142788
SMART Domains Protein: ENSMUSP00000136063
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 63 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143788
Predicted Effect probably benign
Transcript: ENSMUST00000147437
SMART Domains Protein: ENSMUSP00000117394
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 115 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197048
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, abnormal extraembryonic tissue development, poorly developed head fold and trunk and severely reduced primordial germ cell numbers due to a failure to transit to mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Ctdnep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03246:Ctdnep1 APN 11 69984330 unclassified probably benign
R0118:Ctdnep1 UTSW 11 69988731 critical splice donor site probably null
R1521:Ctdnep1 UTSW 11 69988635 missense probably damaging 1.00
R2980:Ctdnep1 UTSW 11 69988671 missense probably damaging 0.97
R3932:Ctdnep1 UTSW 11 69989574 unclassified probably benign
R4117:Ctdnep1 UTSW 11 69988671 missense probably damaging 0.97
R5383:Ctdnep1 UTSW 11 69984396 unclassified probably benign
R5485:Ctdnep1 UTSW 11 69981490 missense possibly damaging 0.93
R5913:Ctdnep1 UTSW 11 69988865 missense probably damaging 1.00
R6214:Ctdnep1 UTSW 11 69989508 missense probably damaging 1.00
R7733:Ctdnep1 UTSW 11 69990009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCTAATCATGTCCAGTGCC -3'
(R):5'- CACACCTTGAGGATGAAGTCGG -3'

Sequencing Primer
(F):5'- ATGTCCAGTGCCCAGCATATG -3'
(R):5'- AGGTGTCCCAGGTCTCACTGTAG -3'
Posted On2018-07-24