Incidental Mutation 'R6706:Eno4'
ID528963
Institutional Source Beutler Lab
Gene Symbol Eno4
Ensembl Gene ENSMUSG00000048029
Gene Nameenolase 4
Synonyms6430537H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58943425-58971421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58970680 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 411 (E411D)
Ref Sequence ENSEMBL: ENSMUSP00000144656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000054280] [ENSMUST00000163821] [ENSMUST00000200910] [ENSMUST00000202382]
Predicted Effect probably benign
Transcript: ENSMUST00000047511
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054280
AA Change: E599D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000062584
Gene: ENSMUSG00000048029
AA Change: E599D

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 69 264 1.06e-20 SMART
Enolase_C 276 585 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163821
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200910
AA Change: E598D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144272
Gene: ENSMUSG00000048029
AA Change: E598D

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 68 263 1.06e-20 SMART
Enolase_C 275 584 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201123
Predicted Effect probably benign
Transcript: ENSMUST00000202382
AA Change: E411D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144656
Gene: ENSMUSG00000048029
AA Change: E411D

DomainStartEndE-ValueType
Blast:Enolase_N 1 88 1e-22 BLAST
Enolase_C 100 409 2.1e-45 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility associated with abnormal sperm morphology, number and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Eno4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Eno4 APN 19 58943545 missense possibly damaging 0.92
IGL02486:Eno4 APN 19 58945665 splice site probably null
IGL03087:Eno4 APN 19 58962816 missense possibly damaging 0.55
IGL03207:Eno4 APN 19 58953205 missense probably benign 0.04
R0048:Eno4 UTSW 19 58964538 missense possibly damaging 0.70
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0362:Eno4 UTSW 19 58943624 splice site probably benign
R2376:Eno4 UTSW 19 58953226 missense probably benign
R4387:Eno4 UTSW 19 58953208 missense probably benign 0.01
R4678:Eno4 UTSW 19 58946749 missense probably damaging 0.99
R4696:Eno4 UTSW 19 58945636 missense probably damaging 0.96
R4896:Eno4 UTSW 19 58964543 missense probably damaging 1.00
R4932:Eno4 UTSW 19 58964457 missense possibly damaging 0.82
R5050:Eno4 UTSW 19 58955496 missense probably benign 0.00
R5092:Eno4 UTSW 19 58945591 missense probably benign 0.02
R5104:Eno4 UTSW 19 58945541 missense probably benign 0.05
R5300:Eno4 UTSW 19 58955550 critical splice donor site probably null
R5450:Eno4 UTSW 19 58960247 missense possibly damaging 0.65
R5689:Eno4 UTSW 19 58970656 missense probably benign 0.01
R5698:Eno4 UTSW 19 58968472 intron probably null
R5874:Eno4 UTSW 19 58946806 missense probably benign
R6027:Eno4 UTSW 19 58946830 missense probably damaging 1.00
R6316:Eno4 UTSW 19 58960291 critical splice donor site probably null
R6494:Eno4 UTSW 19 58962794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTTCTGAGAGCTCTGG -3'
(R):5'- CGAAAGCATGCACACGTTGG -3'

Sequencing Primer
(F):5'- CTGAGAGCTCTGGATCCTTTTG -3'
(R):5'- ACGTTGGTGATTATACTCATTTACGG -3'
Posted On2018-07-24