Incidental Mutation 'R6707:Zp2'
ID528977
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Namezona pellucida glycoprotein 2
SynonymsZp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6707 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120126772-120145291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120133922 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 599 (G599R)
Ref Sequence ENSEMBL: ENSMUSP00000147097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033207
AA Change: G599R

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: G599R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208122
Predicted Effect possibly damaging
Transcript: ENSMUST00000208874
AA Change: G599R

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
Adam29 C T 8: 55,872,100 G440R probably damaging Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
Arhgef28 G T 13: 97,936,716 Q1371K probably damaging Het
Arhgef28 T C 13: 98,075,116 T120A possibly damaging Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Klhl21 A G 4: 152,012,327 D350G possibly damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vmn2r90 T C 17: 17,728,102 C537R probably damaging Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 120133400 missense probably benign 0.00
IGL00707:Zp2 APN 7 120133413 missense probably benign 0.03
IGL00916:Zp2 APN 7 120138174 missense probably damaging 1.00
IGL01554:Zp2 APN 7 120138325 missense possibly damaging 0.78
IGL01845:Zp2 APN 7 120138191 missense probably damaging 1.00
IGL02111:Zp2 APN 7 120132418 missense possibly damaging 0.75
IGL02145:Zp2 APN 7 120139851 critical splice acceptor site probably null
IGL02155:Zp2 APN 7 120144117 missense probably benign 0.00
IGL02178:Zp2 APN 7 120133750 missense possibly damaging 0.85
IGL02646:Zp2 APN 7 120135341 missense possibly damaging 0.92
IGL03220:Zp2 APN 7 120137227 missense possibly damaging 0.90
PIT4687001:Zp2 UTSW 7 120141879 missense probably benign 0.00
R0138:Zp2 UTSW 7 120137200 missense probably damaging 0.96
R0197:Zp2 UTSW 7 120143576 splice site probably benign
R0519:Zp2 UTSW 7 120138149 missense probably damaging 1.00
R0573:Zp2 UTSW 7 120135470 splice site probably benign
R0879:Zp2 UTSW 7 120135534 missense probably damaging 1.00
R0883:Zp2 UTSW 7 120143576 splice site probably benign
R1160:Zp2 UTSW 7 120136045 missense probably damaging 1.00
R1235:Zp2 UTSW 7 120138343 missense possibly damaging 0.57
R1753:Zp2 UTSW 7 120138105 missense probably benign
R1883:Zp2 UTSW 7 120133401 missense probably benign 0.02
R1995:Zp2 UTSW 7 120135165 missense probably damaging 0.97
R2196:Zp2 UTSW 7 120138306 missense probably benign
R2850:Zp2 UTSW 7 120138306 missense probably benign
R3715:Zp2 UTSW 7 120141834 missense possibly damaging 0.95
R3931:Zp2 UTSW 7 120132357 intron probably benign
R4082:Zp2 UTSW 7 120135252 missense probably benign 0.01
R4731:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4732:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4733:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4754:Zp2 UTSW 7 120138318 missense probably benign 0.01
R4863:Zp2 UTSW 7 120135772 missense probably damaging 1.00
R5274:Zp2 UTSW 7 120138092 missense possibly damaging 0.92
R5392:Zp2 UTSW 7 120135764 nonsense probably null
R5877:Zp2 UTSW 7 120133339 missense probably null 0.94
R6390:Zp2 UTSW 7 120141230 missense probably benign 0.23
R6404:Zp2 UTSW 7 120135542 missense possibly damaging 0.73
R6546:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120141913 missense probably benign
R7274:Zp2 UTSW 7 120132391 makesense probably null
R7275:Zp2 UTSW 7 120135353 splice site probably null
R7541:Zp2 UTSW 7 120136056 missense probably damaging 1.00
R7585:Zp2 UTSW 7 120133944 missense probably damaging 1.00
R7709:Zp2 UTSW 7 120135775 missense probably damaging 1.00
R7742:Zp2 UTSW 7 120132508 missense unknown
R7767:Zp2 UTSW 7 120137169 missense probably benign 0.01
R7771:Zp2 UTSW 7 120143642 missense probably damaging 0.96
R8391:Zp2 UTSW 7 120126956 missense probably benign 0.00
X0017:Zp2 UTSW 7 120133385 missense probably damaging 1.00
X0023:Zp2 UTSW 7 120133367 missense probably damaging 1.00
Z1176:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCAGGGCAAGTCACAG -3'
(R):5'- AGATGTGATACCTCTATGCTACATC -3'

Sequencing Primer
(F):5'- CAGGGCAAGTCACAGAGCAC -3'
(R):5'- TGCTACATCTATATTTACATGTGGC -3'
Posted On2018-07-24