Incidental Mutation 'R6707:Adam29'
ID528979
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Namea disintegrin and metallopeptidase domain 29
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_175939; MGI: 2676326

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6707 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location55870912-55906948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55872100 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 440 (G440R)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
Predicted Effect probably damaging
Transcript: ENSMUST00000053441
AA Change: G440R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: G440R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
Arhgef28 G T 13: 97,936,716 Q1371K probably damaging Het
Arhgef28 T C 13: 98,075,116 T120A possibly damaging Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Klhl21 A G 4: 152,012,327 D350G possibly damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vmn2r90 T C 17: 17,728,102 C537R probably damaging Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Zp2 C T 7: 120,133,922 G599R possibly damaging Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 55871844 missense probably benign 0.01
IGL01406:Adam29 APN 8 55871839 missense probably damaging 1.00
IGL01511:Adam29 APN 8 55871421 missense probably damaging 1.00
IGL01869:Adam29 APN 8 55871697 missense probably damaging 0.99
IGL01894:Adam29 APN 8 55871830 missense probably benign 0.00
IGL02023:Adam29 APN 8 55872484 missense probably benign 0.12
IGL02030:Adam29 APN 8 55872122 missense probably benign 0.35
IGL02071:Adam29 APN 8 55871554 missense possibly damaging 0.95
IGL02094:Adam29 APN 8 55871445 missense possibly damaging 0.48
IGL02108:Adam29 APN 8 55872311 missense probably damaging 0.98
IGL02125:Adam29 APN 8 55871939 nonsense probably null
IGL02330:Adam29 APN 8 55872363 missense probably benign 0.02
IGL02332:Adam29 APN 8 55871740 missense probably damaging 1.00
IGL02548:Adam29 APN 8 55872867 nonsense probably null
IGL02960:Adam29 APN 8 55872666 nonsense probably null
IGL03030:Adam29 APN 8 55873065 missense probably damaging 1.00
ANU22:Adam29 UTSW 8 55871844 missense probably benign 0.01
D4043:Adam29 UTSW 8 55872461 nonsense probably null
IGL02835:Adam29 UTSW 8 55873138 missense probably damaging 1.00
R0294:Adam29 UTSW 8 55873276 missense probably benign 0.25
R0449:Adam29 UTSW 8 55872681 missense probably benign 0.01
R0607:Adam29 UTSW 8 55873275 missense probably damaging 1.00
R0626:Adam29 UTSW 8 55871577 missense probably benign 0.24
R1296:Adam29 UTSW 8 55871719 nonsense probably null
R1752:Adam29 UTSW 8 55872274 missense probably damaging 0.98
R1930:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R1931:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R2397:Adam29 UTSW 8 55872898 missense probably benign 0.04
R2764:Adam29 UTSW 8 55871756 missense probably damaging 1.00
R4052:Adam29 UTSW 8 55872282 missense probably damaging 1.00
R4978:Adam29 UTSW 8 55871401 missense probably damaging 0.98
R5306:Adam29 UTSW 8 55871757 missense probably damaging 1.00
R6383:Adam29 UTSW 8 55871508 missense probably damaging 0.99
R6528:Adam29 UTSW 8 55872561 missense possibly damaging 0.93
R6579:Adam29 UTSW 8 55872744 missense probably damaging 1.00
R7076:Adam29 UTSW 8 55871659 missense probably damaging 1.00
R7099:Adam29 UTSW 8 55871404 missense probably benign 0.01
R7177:Adam29 UTSW 8 55872624 missense probably benign 0.30
R7320:Adam29 UTSW 8 55872714 missense possibly damaging 0.50
R7420:Adam29 UTSW 8 55872898 missense probably benign 0.04
R7438:Adam29 UTSW 8 55871574 missense probably damaging 0.99
R7476:Adam29 UTSW 8 55873195 missense probably damaging 0.97
R7524:Adam29 UTSW 8 55872360 missense probably damaging 1.00
R8066:Adam29 UTSW 8 55872668 missense probably benign 0.11
R8111:Adam29 UTSW 8 55871550 missense probably benign 0.00
R8221:Adam29 UTSW 8 55872428 missense probably benign 0.02
R8353:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
R8453:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
X0011:Adam29 UTSW 8 55873168 missense probably benign 0.02
Z1177:Adam29 UTSW 8 55871496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCATTGCGGTCATTAC -3'
(R):5'- ACCCAAATTCAGCAATTGTAGC -3'

Sequencing Primer
(F):5'- GCGGTCATTACATTGCTTTTCATAG -3'
(R):5'- ACTTTTGGTCTTACACTGTAAAGAAC -3'
Posted On2018-07-24