Mutagenetix > Incidental Mutations

Incidental Mutation 'R6707:Ireb2'

528982

Institutional Source

Beutler Lab

Gene Symbol

Ireb2

Ensembl Gene

ENSMUSG00000032293

Gene Name

iron responsive element binding protein 2

Synonyms

D9Ertd85e, Irp2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6707 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54863789-54912530 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54903961 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 716 (T716I)

Ref Sequence

ENSEMBL: ENSMUSP00000034843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034843]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034843
AA Change: T716I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: T716I

Domain	Start	End	E-Value	Type
Pfam:Aconitase	59	155	6.5e-16	PFAM
Pfam:Aconitase	186	639	2e-129	PFAM
Pfam:Aconitase_C	767	896	1.5e-44	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213482

Predicted Effect

unknown
Transcript: ENSMUST00000214023
AA Change: T216I

Meta Mutation Damage Score

0.5610

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (42/42)

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,223,122	V1943M	probably benign	Het
Acss3	T	C	10: 107,084,922	Y109C	probably damaging	Het
Actg2	C	T	6: 83,513,094	W341*	probably null	Het
Adam29	C	T	8: 55,872,100	G440R	probably damaging	Het
AI314180	T	A	4: 58,879,101	I63L	possibly damaging	Het
Arfgef3	T	C	10: 18,621,155	D1153G	probably benign	Het
Arhgef28	G	T	13: 97,936,716	Q1371K	probably damaging	Het
Arhgef28	T	C	13: 98,075,116	T120A	possibly damaging	Het
BC051665	A	T	13: 60,784,408	D122E	probably benign	Het
Boc	A	T	16: 44,500,616	I227N	possibly damaging	Het
Clca3b	T	A	3: 144,844,527	Q219L	probably benign	Het
Cyp2c66	T	A	19: 39,186,500	F448Y	probably damaging	Het
Ddx5	A	G	11: 106,782,232	M489T	probably benign	Het
Dnm1	T	C	2: 32,336,241	D312G	probably null	Het
Eqtn	T	C	4: 94,907,819	D215G	probably benign	Het
Evi5l	A	T	8: 4,206,322	T706S	probably benign	Het
Gtf2f1	T	C	17: 57,007,770	E90G	probably benign	Het
Hpx	A	T	7: 105,595,475	S168T	probably benign	Het
Ipo4	C	A	14: 55,628,904	V773L	possibly damaging	Het
Klhl21	A	G	4: 152,012,327	D350G	possibly damaging	Het
Myh13	A	T	11: 67,350,260	N821I	probably damaging	Het
Nipbl	G	T	15: 8,324,559	T1698K	probably benign	Het
Nod2	A	G	8: 88,665,189	H686R	probably benign	Het
Ntf3	A	G	6: 126,164,728		probably null	Het
Olfr811	G	T	10: 129,801,820	A235D	probably damaging	Het
Olfr816	T	C	10: 129,911,739	T180A	probably benign	Het
Parp9	A	T	16: 35,947,933	H161L	probably damaging	Het
Pkhd1l1	A	G	15: 44,529,143	N1625D	probably benign	Het
Rdx	T	C	9: 52,063,654	F30S	probably damaging	Het
Smo	T	A	6: 29,736,174	V55E	probably benign	Het
Sox9	C	A	11: 112,782,872	N96K	probably damaging	Het
Spp2	T	G	1: 88,417,294		probably null	Het
Tex46	A	G	4: 136,612,850	N82S	probably benign	Het
Timm22	C	T	11: 76,407,325	L41F	possibly damaging	Het
Tmem30a	A	T	9: 79,774,265	Y207*	probably null	Het
Tmem70	T	C	1: 16,677,307	V216A	probably damaging	Het
Tspan18	T	C	2: 93,209,957	N151S	probably benign	Het
Vmn2r90	T	C	17: 17,728,102	C537R	probably damaging	Het
Vps50	A	G	6: 3,545,583	Y339C	probably damaging	Het
Zp2	C	T	7: 120,133,922	G599R	possibly damaging	Het

Other mutations in Ireb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ireb2	APN	9	54899482	splice site	probably benign
IGL01576:Ireb2	APN	9	54892510	missense	probably damaging	1.00
IGL01844:Ireb2	APN	9	54865357	missense	probably benign	0.01
bonkers	UTSW	9	54896495	missense	probably benign	0.00
homicidal	UTSW	9	54886567	nonsense	probably null
remorseless	UTSW	9	54882333	missense	possibly damaging	0.83
tony_stark	UTSW	9	54903961	missense	probably damaging	1.00
R0143:Ireb2	UTSW	9	54885909	missense	probably benign	0.06
R0279:Ireb2	UTSW	9	54886593	missense	probably benign
R0400:Ireb2	UTSW	9	54896498	missense	probably benign
R0565:Ireb2	UTSW	9	54899983	missense	probably damaging	1.00
R0686:Ireb2	UTSW	9	54904176	missense	probably benign	0.44
R0706:Ireb2	UTSW	9	54892486	missense	probably benign
R0894:Ireb2	UTSW	9	54896577	missense	probably damaging	1.00
R1101:Ireb2	UTSW	9	54909702	missense	probably benign	0.35
R1680:Ireb2	UTSW	9	54881518	missense	probably damaging	1.00
R2074:Ireb2	UTSW	9	54881449	missense	probably benign
R2080:Ireb2	UTSW	9	54896552	missense	possibly damaging	0.85
R2891:Ireb2	UTSW	9	54899990	missense	probably benign	0.01
R3153:Ireb2	UTSW	9	54885946	critical splice donor site	probably null
R3154:Ireb2	UTSW	9	54885946	critical splice donor site	probably null
R3844:Ireb2	UTSW	9	54892505	missense	probably damaging	0.99
R4128:Ireb2	UTSW	9	54881432	missense	probably benign	0.32
R4803:Ireb2	UTSW	9	54906814	missense	probably benign	0.01
R5097:Ireb2	UTSW	9	54895384	missense	probably benign	0.04
R5159:Ireb2	UTSW	9	54892547	missense	probably benign
R5227:Ireb2	UTSW	9	54896601	critical splice donor site	probably null
R5767:Ireb2	UTSW	9	54900516	missense	probably benign
R6005:Ireb2	UTSW	9	54908805	missense	probably damaging	1.00
R6127:Ireb2	UTSW	9	54882368	missense	probably benign
R6155:Ireb2	UTSW	9	54886527	missense	probably damaging	1.00
R6170:Ireb2	UTSW	9	54887372	missense	probably benign	0.00
R6341:Ireb2	UTSW	9	54908780	missense	probably damaging	0.99
R6973:Ireb2	UTSW	9	54882387	missense	probably benign	0.00
R7108:Ireb2	UTSW	9	54906641	missense	probably damaging	1.00
R7126:Ireb2	UTSW	9	54886567	nonsense	probably null
R7314:Ireb2	UTSW	9	54892510	missense	probably damaging	1.00
R7396:Ireb2	UTSW	9	54882333	missense	possibly damaging	0.83
R7472:Ireb2	UTSW	9	54884054	missense	probably benign	0.11
R7590:Ireb2	UTSW	9	54896495	missense	probably benign	0.00
R7842:Ireb2	UTSW	9	54909686	missense	probably benign	0.01
R7894:Ireb2	UTSW	9	54882336	missense	probably damaging	1.00
R8443:Ireb2	UTSW	9	54903981	missense	possibly damaging	0.94
RF006:Ireb2	UTSW	9	54881484	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GGGGAGAATGGCTCTATGAC -3'
(R):5'- CTCAATAGGCTGGGATGCAG -3'

Sequencing Primer
(F):5'- AATTGCTCCTAAAAATGTGGTGGG -3'
(R):5'- CAGCTGGCTCTTTGGTCTAAAAAGAC -3'

Posted On

2018-07-24