Incidental Mutation 'R6707:Vmn2r90'
ID529001
Institutional Source Beutler Lab
Gene Symbol Vmn2r90
Ensembl Gene ENSMUSG00000092120
Gene Namevomeronasal 2, receptor 90
SynonymsEG626942
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6707 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location17703747-17735156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17728102 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000126650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169805] [ENSMUST00000231659] [ENSMUST00000232078] [ENSMUST00000232113]
Predicted Effect probably damaging
Transcript: ENSMUST00000169805
AA Change: C537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126650
Gene: ENSMUSG00000092120
AA Change: C537R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-43 PFAM
Pfam:NCD3G 514 567 3e-22 PFAM
Pfam:7tm_3 600 835 9.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231659
Predicted Effect probably benign
Transcript: ENSMUST00000232078
Predicted Effect probably benign
Transcript: ENSMUST00000232113
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
Adam29 C T 8: 55,872,100 G440R probably damaging Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
Arhgef28 G T 13: 97,936,716 Q1371K probably damaging Het
Arhgef28 T C 13: 98,075,116 T120A possibly damaging Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Klhl21 A G 4: 152,012,327 D350G possibly damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Zp2 C T 7: 120,133,922 G599R possibly damaging Het
Other mutations in Vmn2r90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vmn2r90 APN 17 17733496 missense probably benign 0.00
IGL01330:Vmn2r90 APN 17 17733280 missense probably benign 0.00
IGL01989:Vmn2r90 APN 17 17713232 nonsense probably null
IGL02080:Vmn2r90 APN 17 17712858 missense probably damaging 1.00
IGL02112:Vmn2r90 APN 17 17712203 missense probably damaging 0.98
IGL02123:Vmn2r90 APN 17 17733482 missense probably benign 0.01
IGL02749:Vmn2r90 APN 17 17726860 makesense probably null
IGL03114:Vmn2r90 APN 17 17733509 missense probably damaging 1.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0132:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0184:Vmn2r90 UTSW 17 17726877 nonsense probably null
R0379:Vmn2r90 UTSW 17 17728139 missense probably damaging 1.00
R1022:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1024:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1897:Vmn2r90 UTSW 17 17733304 missense probably damaging 1.00
R1993:Vmn2r90 UTSW 17 17713263 missense probably damaging 1.00
R2472:Vmn2r90 UTSW 17 17728146 missense probably damaging 1.00
R2508:Vmn2r90 UTSW 17 17733967 missense probably damaging 1.00
R2679:Vmn2r90 UTSW 17 17712869 missense possibly damaging 0.46
R3409:Vmn2r90 UTSW 17 17733376 missense probably benign 0.00
R4693:Vmn2r90 UTSW 17 17733694 missense possibly damaging 0.91
R4797:Vmn2r90 UTSW 17 17712305 missense probably damaging 1.00
R5258:Vmn2r90 UTSW 17 17712852 missense probably benign 0.12
R5358:Vmn2r90 UTSW 17 17704150 critical splice donor site probably null
R5445:Vmn2r90 UTSW 17 17734124 missense probably benign 0.04
R5446:Vmn2r90 UTSW 17 17712202 missense probably damaging 0.99
R5567:Vmn2r90 UTSW 17 17712074 missense probably damaging 1.00
R5680:Vmn2r90 UTSW 17 17726772 missense possibly damaging 0.93
R5686:Vmn2r90 UTSW 17 17713450 missense probably benign 0.02
R5751:Vmn2r90 UTSW 17 17733866 missense probably damaging 0.96
R6156:Vmn2r90 UTSW 17 17733344 missense probably benign 0.01
R6185:Vmn2r90 UTSW 17 17733382 missense probably damaging 1.00
R6450:Vmn2r90 UTSW 17 17733236 missense possibly damaging 0.47
R6802:Vmn2r90 UTSW 17 17712089 missense probably damaging 1.00
R6913:Vmn2r90 UTSW 17 17704061 missense probably damaging 1.00
R7070:Vmn2r90 UTSW 17 17704051 missense probably damaging 0.98
R7237:Vmn2r90 UTSW 17 17703987 missense possibly damaging 0.92
R7503:Vmn2r90 UTSW 17 17713248 missense not run
R7698:Vmn2r90 UTSW 17 17733334 missense probably benign
R7943:Vmn2r90 UTSW 17 17712304 missense probably damaging 1.00
R8072:Vmn2r90 UTSW 17 17726880 missense probably damaging 1.00
R8128:Vmn2r90 UTSW 17 17733893 missense probably damaging 1.00
R8295:Vmn2r90 UTSW 17 17728096 missense probably benign 0.03
R8345:Vmn2r90 UTSW 17 17712865 nonsense probably null
Z1088:Vmn2r90 UTSW 17 17733617 missense probably damaging 1.00
Z1176:Vmn2r90 UTSW 17 17712817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGTAGCCCAAAATCTAAC -3'
(R):5'- GGAACAAGATCTGAAATTTCACAGC -3'

Sequencing Primer
(F):5'- CCTTATTGTAAGTGTAAGCATTTGC -3'
(R):5'- TGCAATGTTCCCATTTTAATCAAGGG -3'
Posted On2018-07-24