Incidental Mutation 'R6708:Pogk'
ID529004
Institutional Source Beutler Lab
Gene Symbol Pogk
Ensembl Gene ENSMUSG00000040596
Gene Namepogo transposable element with KRAB domain
SynonymsBASS2, 9130401E23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location166384622-166409863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166403509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000120963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127596] [ENSMUST00000128861] [ENSMUST00000131487] [ENSMUST00000135673] [ENSMUST00000148243] [ENSMUST00000169324]
Predicted Effect probably damaging
Transcript: ENSMUST00000127596
AA Change: V83A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120963
Gene: ENSMUSG00000040596
AA Change: V83A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 105 6.31e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128861
AA Change: V90A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118270
Gene: ENSMUSG00000040596
AA Change: V90A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131487
AA Change: V90A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116477
Gene: ENSMUSG00000040596
AA Change: V90A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135673
AA Change: V102A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120352
Gene: ENSMUSG00000040596
AA Change: V102A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148243
SMART Domains Protein: ENSMUSP00000118877
Gene: ENSMUSG00000040596

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169324
AA Change: V102A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127395
Gene: ENSMUSG00000040596
AA Change: V102A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
KRAB 66 126 1.53e-19 SMART
Pfam:BrkDBD 214 266 8.7e-29 PFAM
CENPB 275 342 3.93e-21 SMART
Pfam:DDE_1 414 586 1.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known. However, this gene product contains a KRAB domain (which is involved in protein-protein interactions) at the N-terminus, and a transposase domain at the C-terminus, suggesting that it may belong to the family of DNA-mediated transposons in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Pogk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pogk APN 1 166408478 missense probably damaging 1.00
R0395:Pogk UTSW 1 166403602 missense probably damaging 1.00
R1387:Pogk UTSW 1 166400138 missense possibly damaging 0.85
R1556:Pogk UTSW 1 166398833 missense possibly damaging 0.59
R1752:Pogk UTSW 1 166408428 missense probably damaging 0.96
R3625:Pogk UTSW 1 166403512 missense probably damaging 1.00
R3901:Pogk UTSW 1 166403624 missense probably damaging 1.00
R3902:Pogk UTSW 1 166403624 missense probably damaging 1.00
R4288:Pogk UTSW 1 166403506 missense probably damaging 1.00
R4612:Pogk UTSW 1 166398765 nonsense probably null
R5079:Pogk UTSW 1 166399164 missense probably damaging 1.00
R5788:Pogk UTSW 1 166409011 intron probably benign
R6488:Pogk UTSW 1 166399422 missense possibly damaging 0.79
R7603:Pogk UTSW 1 166401911 missense probably benign 0.03
R8100:Pogk UTSW 1 166401942 missense possibly damaging 0.95
X0010:Pogk UTSW 1 166398797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAATTAGGTTGACATAGGC -3'
(R):5'- GTGAGCATATAGACAGAGCACC -3'

Sequencing Primer
(F):5'- AAATTAGGTTGACATAGGCTTGGGC -3'
(R):5'- CCCTGAAGTGACCTGTGAGAATG -3'
Posted On2018-07-24