Incidental Mutation 'R6708:Orc4'
ID529005
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48937493 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 29 (H29Q)
Ref Sequence ENSEMBL: ENSMUSP00000088497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: H29Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: H29Q

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
AA Change: H29Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: H29Q

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123271
AA Change: H29Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably benign
Transcript: ENSMUST00000142851
AA Change: H29Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: H29Q

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149679
AA Change: H29Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761
AA Change: H29Q

DomainStartEndE-ValueType
SCOP:d1jbka_ 43 73 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7572:Orc4 UTSW 2 48910236 missense probably benign 0.01
R7938:Orc4 UTSW 2 48910191 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGCTACCAGGTGTTAAGTACCAG -3'
(R):5'- GTTCTGCCATTCACTGACGTG -3'

Sequencing Primer
(F):5'- CTACCAGGTGTTAAGTACCAGAATTC -3'
(R):5'- GACGTGACATCTCATTATTTACCTG -3'
Posted On2018-07-24