Incidental Mutation 'R6708:Elf5'
ID529006
Institutional Source Beutler Lab
Gene Symbol Elf5
Ensembl Gene ENSMUSG00000027186
Gene NameE74-like factor 5
SynonymsESE-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location103411688-103450989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103448989 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 185 (D185G)
Ref Sequence ENSEMBL: ENSMUSP00000118565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028609] [ENSMUST00000028610] [ENSMUST00000126290] [ENSMUST00000164172] [ENSMUST00000171693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028609
AA Change: D185G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028609
Gene: ENSMUSG00000027186
AA Change: D185G

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028610
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123793
Predicted Effect probably damaging
Transcript: ENSMUST00000126290
AA Change: D185G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118565
Gene: ENSMUSG00000027186
AA Change: D185G

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 199 4.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152055
Predicted Effect possibly damaging
Transcript: ENSMUST00000164172
AA Change: D185G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126941
Gene: ENSMUSG00000027186
AA Change: D185G

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171693
AA Change: D185G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131940
Gene: ENSMUSG00000027186
AA Change: D185G

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. Embryos homozygous for one null allele failed to develop extraembryonic ectoderm, did not maintain trophoblast stem cells, and had abnormal or absent mesoderm. Mice heterozygous for another allele had impaired lactation and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Elf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Elf5 APN 2 103442861 splice site probably benign
IGL03162:Elf5 APN 2 103430406 missense possibly damaging 0.56
R0329:Elf5 UTSW 2 103430420 splice site probably benign
R4667:Elf5 UTSW 2 103449060 missense probably damaging 1.00
R4906:Elf5 UTSW 2 103449573 nonsense probably null
R5768:Elf5 UTSW 2 103449022 missense probably damaging 1.00
R6307:Elf5 UTSW 2 103439412 missense probably damaging 1.00
R6418:Elf5 UTSW 2 103439352 missense possibly damaging 0.92
R6526:Elf5 UTSW 2 103439233 missense probably damaging 1.00
R7199:Elf5 UTSW 2 103439296 missense possibly damaging 0.70
R7263:Elf5 UTSW 2 103439300 missense probably benign 0.25
R7646:Elf5 UTSW 2 103439243 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCAGCAACAGTTCTTACAGGT -3'
(R):5'- CCGGCCCCGCTATTTTATAT -3'

Sequencing Primer
(F):5'- GCTTCCACTGGATATTACTAGGAGAC -3'
(R):5'- ATAACTTGTCTTTGCAGGTTCAC -3'
Posted On2018-07-24