Incidental Mutation 'R6708:Btbd3'
ID529007
Institutional Source Beutler Lab
Gene Symbol Btbd3
Ensembl Gene ENSMUSG00000062098
Gene NameBTB (POZ) domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location138256565-138589292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138283571 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000074864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075410] [ENSMUST00000091556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075410
AA Change: E225G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074864
Gene: ENSMUSG00000062098
AA Change: E225G

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
low complexity region 63 69 N/A INTRINSIC
low complexity region 89 101 N/A INTRINSIC
BTB 128 228 5.55e-23 SMART
BACK 234 343 1.11e-12 SMART
Pfam:PHR 384 529 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091556
AA Change: E156G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089144
Gene: ENSMUSG00000062098
AA Change: E156G

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 59 159 5.55e-23 SMART
BACK 165 274 1.11e-12 SMART
Pfam:PHR 315 461 8.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155646
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Btbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd3 APN 2 138279777 missense probably benign 0.05
IGL01650:Btbd3 APN 2 138284105 missense probably damaging 1.00
IGL01783:Btbd3 APN 2 138283736 missense probably damaging 1.00
IGL03108:Btbd3 APN 2 138284123 missense possibly damaging 0.55
IGL03232:Btbd3 APN 2 138284143 missense probably damaging 1.00
IGL03259:Btbd3 APN 2 138279760 missense probably damaging 1.00
IGL03405:Btbd3 APN 2 138279761 missense probably damaging 0.98
R0540:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R0607:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R1171:Btbd3 UTSW 2 138283961 missense probably benign 0.03
R1983:Btbd3 UTSW 2 138283688 missense probably damaging 0.99
R2034:Btbd3 UTSW 2 138278983 missense probably benign 0.15
R5111:Btbd3 UTSW 2 138278909 start codon destroyed probably null 0.53
R6170:Btbd3 UTSW 2 138278942 missense probably damaging 1.00
R6663:Btbd3 UTSW 2 138279083 missense probably benign 0.00
R7210:Btbd3 UTSW 2 138283744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGTTCTTGGACAGGCTTGAAAG -3'
(R):5'- GCATTCAGAGTTTCCCTGCG -3'

Sequencing Primer
(F):5'- GCAGTGGCTTCCTTCCTTG -3'
(R):5'- AGAGTTTCCCTGCGGAGGATAC -3'
Posted On2018-07-24