Incidental Mutation 'R6708:Elavl2'
ID529010
Institutional Source Beutler Lab
Gene Symbol Elavl2
Ensembl Gene ENSMUSG00000008489
Gene NameELAV like RNA binding protein 1
Synonymsmel-N1, Hub
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location91250763-91400785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91253397 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 295 (I295N)
Ref Sequence ENSEMBL: ENSMUSP00000102728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008633] [ENSMUST00000102799] [ENSMUST00000107109] [ENSMUST00000107110] [ENSMUST00000107111] [ENSMUST00000107116] [ENSMUST00000107118] [ENSMUST00000107120] [ENSMUST00000107124]
Predicted Effect probably damaging
Transcript: ENSMUST00000008633
AA Change: I309N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008633
Gene: ENSMUSG00000008489
AA Change: I309N

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 278 351 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102799
AA Change: I322N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099863
Gene: ENSMUSG00000008489
AA Change: I322N

DomainStartEndE-ValueType
RRM 54 127 1.44e-24 SMART
RRM 140 215 2.35e-20 SMART
RRM 291 364 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107109
AA Change: I308N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102726
Gene: ENSMUSG00000008489
AA Change: I308N

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107110
AA Change: I296N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102727
Gene: ENSMUSG00000008489
AA Change: I296N

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 265 338 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107111
AA Change: I295N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102728
Gene: ENSMUSG00000008489
AA Change: I295N

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 264 337 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107116
AA Change: I338N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102733
Gene: ENSMUSG00000008489
AA Change: I338N

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 307 380 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107118
AA Change: I325N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102735
Gene: ENSMUSG00000008489
AA Change: I325N

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 294 367 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107120
AA Change: I337N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102737
Gene: ENSMUSG00000008489
AA Change: I337N

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 306 379 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107124
AA Change: I308N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102741
Gene: ENSMUSG00000008489
AA Change: I308N

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a neural-specific RNA-binding protein that is known to bind to several 3' UTRs, including its own and also that of FOS and ID. The encoded protein may recognize a GAAA motif in the RNA. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Elavl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Elavl2 APN 4 91264072 missense probably damaging 1.00
IGL01886:Elavl2 APN 4 91264093 missense probably damaging 1.00
IGL02016:Elavl2 APN 4 91260935 missense probably damaging 1.00
IGL02024:Elavl2 APN 4 91253539 missense probably benign 0.02
IGL02860:Elavl2 APN 4 91260953 missense probably damaging 1.00
R0458:Elavl2 UTSW 4 91308867 splice site probably benign
R1294:Elavl2 UTSW 4 91311589 missense probably benign 0.02
R1778:Elavl2 UTSW 4 91253478 missense probably damaging 1.00
R2063:Elavl2 UTSW 4 91253450 missense possibly damaging 0.81
R2190:Elavl2 UTSW 4 91264094 missense probably benign 0.22
R3773:Elavl2 UTSW 4 91264088 missense probably damaging 1.00
R4473:Elavl2 UTSW 4 91261009 splice site probably null
R4784:Elavl2 UTSW 4 91254142 missense probably null 0.97
R4911:Elavl2 UTSW 4 91308678 missense possibly damaging 0.91
R5396:Elavl2 UTSW 4 91260818 missense probably damaging 1.00
R6882:Elavl2 UTSW 4 91308715 missense probably damaging 1.00
R7592:Elavl2 UTSW 4 91311571 critical splice donor site probably null
R7849:Elavl2 UTSW 4 91372043 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGACAAGAGCTCATTAGGC -3'
(R):5'- TGCTGTAACCAATCTATGTTCCTTG -3'

Sequencing Primer
(F):5'- ACAAGAGCTCATTAGGCTTTGTGC -3'
(R):5'- ACCAATCTATGTTCCTTGTATGTGTG -3'
Posted On2018-07-24