Incidental Mutation 'R6708:Emx1'
ID529011
Institutional Source Beutler Lab
Gene Symbol Emx1
Ensembl Gene ENSMUSG00000033726
Gene Nameempty spiracles homeobox 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6708 (G1)
Quality Score136.008
Status Not validated
Chromosome6
Chromosomal Location85187438-85204462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85194140 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 175 (E175G)
Ref Sequence ENSEMBL: ENSMUSP00000046026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045942]
Predicted Effect probably damaging
Transcript: ENSMUST00000045942
AA Change: E175G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046026
Gene: ENSMUSG00000033726
AA Change: E175G

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
HOX 159 221 9.33e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with this mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Emx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02891:Emx1 APN 6 85204085 utr 3 prime probably benign
R0943:Emx1 UTSW 6 85203919 nonsense probably null
R1173:Emx1 UTSW 6 85188371 splice site probably benign
R1959:Emx1 UTSW 6 85203934 missense probably damaging 1.00
R2483:Emx1 UTSW 6 85188255 missense probably benign
R2511:Emx1 UTSW 6 85204051 missense probably benign 0.03
R5012:Emx1 UTSW 6 85203973 missense probably benign 0.14
R7170:Emx1 UTSW 6 85188001 missense probably benign 0.32
R8315:Emx1 UTSW 6 85194106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGAGTGGATTCTGCTCCTCG -3'
(R):5'- AACGAGGTGGCTTTTGGAACC -3'

Sequencing Primer
(F):5'- TTTCAGGGCAGCCACAAG -3'
(R):5'- TGGCTTTTGGAACCCGAAG -3'
Posted On2018-07-24