Mutagenetix > Incidental Mutation

Incidental Mutation 'R6708:Cd163'

529012

Institutional Source

Beutler Lab

Gene Symbol

Cd163

Ensembl Gene

ENSMUSG00000008845

Gene Name

CD163 antigen

Synonyms

MMRRC Submission

044826-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6708 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124281615-124307486 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124286167 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 239 (H239R)

Ref Sequence

ENSEMBL: ENSMUSP00000108160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]

AlphaFold

Q2VLH6

Predicted Effect

probably damaging
Transcript: ENSMUST00000032234
AA Change: H239R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: H239R

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
SR	50	150	1.1e-52	SMART
SR	157	258	1.4e-55	SMART
SR	265	365	7.3e-60	SMART
SR	372	472	1.2e-35	SMART
SR	477	577	2.3e-41	SMART
SR	582	682	9.8e-39	SMART
SR	719	819	1.1e-60	SMART
SR	824	927	4e-24	SMART
SR	930	1030	2.3e-55	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104136

Predicted Effect

probably damaging
Transcript: ENSMUST00000112541
AA Change: H239R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: H239R

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
SR	50	150	2.26e-50	SMART
SR	157	258	3.11e-53	SMART
SR	265	365	1.54e-57	SMART
SR	372	472	2.64e-33	SMART
SR	477	577	5.03e-39	SMART
SR	582	682	2.09e-36	SMART
SR	719	819	2.38e-58	SMART
SR	824	927	8.93e-22	SMART
SR	930	1030	5.06e-53	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Meta Mutation Damage Score

0.2752

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	T	C	8: 41,249,531 (GRCm39)	L547P	probably damaging	Het
Atp8b5	T	G	4: 43,334,249 (GRCm39)	H338Q	probably benign	Het
Btbd3	A	G	2: 138,125,491 (GRCm39)	E225G	possibly damaging	Het
Cdh15	T	C	8: 123,590,294 (GRCm39)	I409T	probably benign	Het
Cep55	T	A	19: 38,048,709 (GRCm39)	S122T	probably benign	Het
Col5a3	G	A	9: 20,686,331 (GRCm39)	P1382L	unknown	Het
Ehmt2	A	T	17: 35,118,875 (GRCm39)	K186*	probably null	Het
Elavl2	A	T	4: 91,141,634 (GRCm39)	I295N	probably damaging	Het
Elf5	A	G	2: 103,279,334 (GRCm39)	D185G	probably damaging	Het
Emx1	A	G	6: 85,171,122 (GRCm39)	E175G	probably damaging	Het
Fan1	T	G	7: 64,022,554 (GRCm39)	N233T	probably benign	Het
Frem2	T	A	3: 53,492,922 (GRCm39)	I1865F	probably benign	Het
Kcnu1	A	G	8: 26,427,739 (GRCm39)	D352G	probably benign	Het
Klhdc1	A	T	12: 69,306,304 (GRCm39)	H247L	possibly damaging	Het
L3mbtl4	A	T	17: 68,937,253 (GRCm39)	T425S	probably benign	Het
Mrpl21	T	C	19: 3,336,890 (GRCm39)	V87A	probably damaging	Het
Or4d11	A	T	19: 12,014,103 (GRCm39)	M1K	probably null	Het
Or5ac21	T	A	16: 59,124,416 (GRCm39)	L301Q	probably damaging	Het
Or6c215	G	T	10: 129,637,689 (GRCm39)	A235D	probably damaging	Het
Orc4	A	T	2: 48,827,505 (GRCm39)	H29Q	probably benign	Het
Pcnx2	C	T	8: 126,587,692 (GRCm39)		probably null	Het
Pogk	A	G	1: 166,231,078 (GRCm39)	V83A	probably damaging	Het
Synm	T	C	7: 67,382,994 (GRCm39)	E1556G	possibly damaging	Het
Tmem109	C	A	19: 10,849,395 (GRCm39)	L153F	probably damaging	Het
Ttc8	A	G	12: 98,909,791 (GRCm39)	T74A	probably damaging	Het
Zfp180	A	T	7: 23,805,521 (GRCm39)	T647S	probably damaging	Het

Other mutations in Cd163

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Cd163	APN	6	124,306,060 (GRCm39)	splice site	probably benign
IGL00755:Cd163	APN	6	124,295,616 (GRCm39)	missense	possibly damaging	0.70
IGL01690:Cd163	APN	6	124,284,277 (GRCm39)	missense	possibly damaging	0.89
IGL02101:Cd163	APN	6	124,284,246 (GRCm39)	nonsense	probably null
IGL02733:Cd163	APN	6	124,302,300 (GRCm39)	missense	probably damaging	1.00
IGL02801:Cd163	APN	6	124,297,488 (GRCm39)	missense	probably benign	0.00
IGL02897:Cd163	APN	6	124,302,486 (GRCm39)	missense	probably damaging	1.00
IGL03074:Cd163	APN	6	124,294,945 (GRCm39)	missense	probably benign	0.00
IGL03283:Cd163	APN	6	124,286,158 (GRCm39)	missense	possibly damaging	0.49
compass	UTSW	6	124,306,045 (GRCm39)	makesense	probably null
hottish	UTSW	6	124,286,167 (GRCm39)	missense	probably damaging	1.00
protractor	UTSW	6	124,288,525 (GRCm39)	missense	probably damaging	1.00
t-square	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R0494:Cd163	UTSW	6	124,288,408 (GRCm39)	missense	probably damaging	1.00
R0554:Cd163	UTSW	6	124,289,619 (GRCm39)	missense	probably benign	0.03
R0622:Cd163	UTSW	6	124,294,311 (GRCm39)	missense	probably damaging	1.00
R1004:Cd163	UTSW	6	124,302,306 (GRCm39)	missense	probably damaging	1.00
R1061:Cd163	UTSW	6	124,286,128 (GRCm39)	missense	probably benign	0.00
R1132:Cd163	UTSW	6	124,286,055 (GRCm39)	nonsense	probably null
R1195:Cd163	UTSW	6	124,302,209 (GRCm39)	splice site	probably benign
R1195:Cd163	UTSW	6	124,302,209 (GRCm39)	splice site	probably benign
R1436:Cd163	UTSW	6	124,304,890 (GRCm39)	missense	possibly damaging	0.47
R1463:Cd163	UTSW	6	124,288,406 (GRCm39)	missense	probably damaging	1.00
R1532:Cd163	UTSW	6	124,289,689 (GRCm39)	missense	possibly damaging	0.91
R1541:Cd163	UTSW	6	124,304,920 (GRCm39)	missense	probably benign
R1654:Cd163	UTSW	6	124,294,540 (GRCm39)	missense	probably damaging	1.00
R1717:Cd163	UTSW	6	124,306,547 (GRCm39)	utr 3 prime	probably benign
R1744:Cd163	UTSW	6	124,283,987 (GRCm39)	missense	possibly damaging	0.94
R2014:Cd163	UTSW	6	124,302,457 (GRCm39)	missense	probably damaging	0.99
R2035:Cd163	UTSW	6	124,297,588 (GRCm39)	missense	probably damaging	0.97
R2095:Cd163	UTSW	6	124,294,781 (GRCm39)	missense	probably damaging	1.00
R2124:Cd163	UTSW	6	124,295,815 (GRCm39)	missense	probably damaging	1.00
R2146:Cd163	UTSW	6	124,286,167 (GRCm39)	missense	probably damaging	1.00
R2353:Cd163	UTSW	6	124,296,115 (GRCm39)	nonsense	probably null
R3854:Cd163	UTSW	6	124,288,525 (GRCm39)	missense	probably damaging	1.00
R4425:Cd163	UTSW	6	124,304,862 (GRCm39)	missense	possibly damaging	0.94
R4631:Cd163	UTSW	6	124,306,045 (GRCm39)	makesense	probably null
R4647:Cd163	UTSW	6	124,297,580 (GRCm39)	missense	probably damaging	1.00
R4713:Cd163	UTSW	6	124,294,577 (GRCm39)	critical splice donor site	probably null
R4803:Cd163	UTSW	6	124,289,389 (GRCm39)	missense	probably damaging	0.99
R4996:Cd163	UTSW	6	124,296,106 (GRCm39)	missense	probably benign	0.00
R5022:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5023:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5032:Cd163	UTSW	6	124,288,628 (GRCm39)	missense	probably damaging	1.00
R5057:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5121:Cd163	UTSW	6	124,294,948 (GRCm39)	missense	probably damaging	1.00
R5436:Cd163	UTSW	6	124,304,923 (GRCm39)	missense	probably benign
R5453:Cd163	UTSW	6	124,289,500 (GRCm39)	missense	probably damaging	1.00
R5723:Cd163	UTSW	6	124,296,022 (GRCm39)	missense	probably benign	0.00
R5929:Cd163	UTSW	6	124,303,568 (GRCm39)	critical splice donor site	probably null
R5943:Cd163	UTSW	6	124,306,561 (GRCm39)	makesense	probably null
R5964:Cd163	UTSW	6	124,303,531 (GRCm39)	missense	probably benign	0.01
R5966:Cd163	UTSW	6	124,297,595 (GRCm39)	nonsense	probably null
R6279:Cd163	UTSW	6	124,294,950 (GRCm39)	nonsense	probably null
R6300:Cd163	UTSW	6	124,294,950 (GRCm39)	nonsense	probably null
R6499:Cd163	UTSW	6	124,281,703 (GRCm39)	missense	probably benign	0.00
R6602:Cd163	UTSW	6	124,288,594 (GRCm39)	missense	probably damaging	1.00
R6767:Cd163	UTSW	6	124,281,738 (GRCm39)	missense	possibly damaging	0.56
R6979:Cd163	UTSW	6	124,294,945 (GRCm39)	missense	probably benign	0.00
R6993:Cd163	UTSW	6	124,294,673 (GRCm39)	missense	probably damaging	1.00
R7345:Cd163	UTSW	6	124,295,897 (GRCm39)	missense	possibly damaging	0.52
R7382:Cd163	UTSW	6	124,288,271 (GRCm39)	splice site	probably null
R7552:Cd163	UTSW	6	124,284,187 (GRCm39)	missense	probably benign	0.08
R7829:Cd163	UTSW	6	124,281,738 (GRCm39)	missense	probably benign	0.04
R8354:Cd163	UTSW	6	124,305,924 (GRCm39)	missense	probably benign	0.43
R8454:Cd163	UTSW	6	124,305,924 (GRCm39)	missense	probably benign	0.43
R8530:Cd163	UTSW	6	124,295,860 (GRCm39)	missense	probably damaging	1.00
R8560:Cd163	UTSW	6	124,294,360 (GRCm39)	missense	possibly damaging	0.86
R8878:Cd163	UTSW	6	124,297,469 (GRCm39)	missense	probably damaging	0.99
R8930:Cd163	UTSW	6	124,294,882 (GRCm39)	missense	probably damaging	1.00
R8932:Cd163	UTSW	6	124,294,882 (GRCm39)	missense	probably damaging	1.00
R9074:Cd163	UTSW	6	124,285,947 (GRCm39)	nonsense	probably null
R9408:Cd163	UTSW	6	124,297,497 (GRCm39)	missense	probably benign	0.39
R9530:Cd163	UTSW	6	124,294,491 (GRCm39)	nonsense	probably null
R9558:Cd163	UTSW	6	124,297,471 (GRCm39)	missense	probably benign	0.01
R9608:Cd163	UTSW	6	124,286,163 (GRCm39)	missense	possibly damaging	0.79
R9685:Cd163	UTSW	6	124,288,384 (GRCm39)	missense	possibly damaging	0.77
Z1177:Cd163	UTSW	6	124,294,344 (GRCm39)	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CCACCGATGCTTAGGAAGAG -3'
(R):5'- ACCCCAGCTGAGACAATAGTGG -3'

Sequencing Primer
(F):5'- TTCCAGGGAAAGTGGGGGAC -3'
(R):5'- TGGAGTGACAGATGCTGACGTC -3'

Posted On

2018-07-24