Incidental Mutation 'R6708:Adam20'
ID529017
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Namea disintegrin and metallopeptidase domain 20
Synonyms4930529F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40793273-40797303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40796494 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 547 (L547P)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
Predicted Effect probably damaging
Transcript: ENSMUST00000056331
AA Change: L547P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: L547P

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 40796047 missense probably benign 0.00
IGL01357:Adam20 APN 8 40796560 missense probably benign 0.09
IGL01877:Adam20 APN 8 40795945 missense probably benign 0.00
IGL02295:Adam20 APN 8 40796836 missense probably damaging 1.00
IGL02683:Adam20 APN 8 40795584 missense probably damaging 0.98
IGL03090:Adam20 APN 8 40794928 missense probably benign 0.00
BB007:Adam20 UTSW 8 40797070 missense probably benign 0.00
BB017:Adam20 UTSW 8 40797070 missense probably benign 0.00
PIT4151001:Adam20 UTSW 8 40795044 missense possibly damaging 0.58
PIT4696001:Adam20 UTSW 8 40794948 missense probably benign 0.20
R0607:Adam20 UTSW 8 40795480 missense probably benign 0.02
R0885:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1018:Adam20 UTSW 8 40796109 nonsense probably null
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1421:Adam20 UTSW 8 40796747 missense possibly damaging 0.48
R1739:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1778:Adam20 UTSW 8 40796661 missense possibly damaging 0.92
R1844:Adam20 UTSW 8 40796043 missense probably benign
R3814:Adam20 UTSW 8 40795675 missense probably damaging 1.00
R3877:Adam20 UTSW 8 40796634 missense possibly damaging 0.75
R4193:Adam20 UTSW 8 40795315 missense probably damaging 0.99
R4357:Adam20 UTSW 8 40795047 missense possibly damaging 0.61
R4846:Adam20 UTSW 8 40795011 missense probably benign 0.10
R5452:Adam20 UTSW 8 40795764 missense probably damaging 0.96
R6559:Adam20 UTSW 8 40796292 missense probably benign 0.03
R6730:Adam20 UTSW 8 40796659 missense probably benign 0.23
R7194:Adam20 UTSW 8 40796412 missense probably benign 0.45
R7323:Adam20 UTSW 8 40795384 missense probably benign 0.45
R7917:Adam20 UTSW 8 40796371 missense probably damaging 1.00
R7930:Adam20 UTSW 8 40797070 missense probably benign 0.00
R7954:Adam20 UTSW 8 40796544 missense probably damaging 1.00
R7964:Adam20 UTSW 8 40796907 missense probably damaging 0.97
R8006:Adam20 UTSW 8 40795907 missense probably benign 0.02
R8125:Adam20 UTSW 8 40794936 missense probably benign 0.01
R8134:Adam20 UTSW 8 40796064 missense probably benign 0.02
R8435:Adam20 UTSW 8 40795035 missense probably damaging 1.00
X0062:Adam20 UTSW 8 40797024 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCTTCCAGAATGGTGCAACG -3'
(R):5'- ACCAATGTCAGGGATTGTCATC -3'

Sequencing Primer
(F):5'- TGGTGCAACGGACATTCAC -3'
(R):5'- TGTCATCCCAAAATGGTAGTCAGTCC -3'
Posted On2018-07-24