Incidental Mutation 'R6708:Klhdc1'
ID529022
Institutional Source Beutler Lab
Gene Symbol Klhdc1
Ensembl Gene ENSMUSG00000051890
Gene Namekelch domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69241176-69284632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69259530 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 247 (H247L)
Ref Sequence ENSEMBL: ENSMUSP00000134180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063445] [ENSMUST00000173419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063445
AA Change: H247L

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068046
Gene: ENSMUSG00000051890
AA Change: H247L

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.4e-11 PFAM
Pfam:Kelch_4 67 122 4.4e-7 PFAM
Pfam:Kelch_6 67 124 1.7e-7 PFAM
Pfam:Kelch_3 79 125 1.8e-8 PFAM
Pfam:Kelch_3 170 205 2.5e-7 PFAM
Pfam:Kelch_2 196 235 2.8e-8 PFAM
Pfam:Kelch_1 196 236 1.4e-6 PFAM
Pfam:Kelch_4 196 245 5.5e-7 PFAM
Pfam:Kelch_3 206 256 3.9e-8 PFAM
Pfam:Kelch_4 247 295 5.3e-10 PFAM
Pfam:Kelch_3 258 307 1.7e-7 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173419
AA Change: H247L

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134180
Gene: ENSMUSG00000051890
AA Change: H247L

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.7e-11 PFAM
Pfam:Kelch_4 67 123 1.7e-8 PFAM
Pfam:Kelch_6 67 124 5.6e-8 PFAM
Pfam:Kelch_1 68 116 3.2e-6 PFAM
Pfam:Kelch_3 78 126 3.1e-9 PFAM
Pfam:Kelch_3 165 205 2.8e-8 PFAM
Pfam:Kelch_5 193 237 2.7e-6 PFAM
Pfam:Kelch_2 196 235 1.8e-8 PFAM
Pfam:Kelch_6 196 237 2.6e-8 PFAM
Pfam:Kelch_4 196 245 2e-7 PFAM
Pfam:Kelch_3 206 256 2.1e-7 PFAM
Pfam:Kelch_5 245 285 2.4e-6 PFAM
Pfam:Kelch_4 247 299 3.5e-11 PFAM
Pfam:Kelch_6 247 299 3.2e-8 PFAM
Pfam:Kelch_3 258 301 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Klhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Klhdc1 APN 12 69242008 missense possibly damaging 0.92
IGL01432:Klhdc1 APN 12 69251977 missense probably damaging 0.97
IGL02086:Klhdc1 APN 12 69283184 missense probably benign 0.18
IGL02212:Klhdc1 APN 12 69250766 missense probably damaging 1.00
IGL02548:Klhdc1 APN 12 69253718 missense probably benign 0.00
IGL02861:Klhdc1 APN 12 69251451 missense possibly damaging 0.85
R0446:Klhdc1 UTSW 12 69283308 missense probably benign
R0656:Klhdc1 UTSW 12 69258030 missense probably benign
R1528:Klhdc1 UTSW 12 69263198 missense probably benign 0.02
R3001:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R3002:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R4428:Klhdc1 UTSW 12 69268226 intron probably benign
R4738:Klhdc1 UTSW 12 69283133 missense probably benign 0.07
R5009:Klhdc1 UTSW 12 69251938 missense possibly damaging 0.89
R5366:Klhdc1 UTSW 12 69283150 missense probably damaging 0.99
R5619:Klhdc1 UTSW 12 69258145 splice site probably null
R5662:Klhdc1 UTSW 12 69283165 missense probably benign 0.07
R5911:Klhdc1 UTSW 12 69256251 missense possibly damaging 0.80
R5995:Klhdc1 UTSW 12 69250774 missense probably damaging 1.00
R6992:Klhdc1 UTSW 12 69253757 missense probably damaging 1.00
R7224:Klhdc1 UTSW 12 69263149 missense probably damaging 1.00
R7597:Klhdc1 UTSW 12 69269868 missense probably damaging 1.00
R7833:Klhdc1 UTSW 12 69283168 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCTGGATATACATAGTGGAGC -3'
(R):5'- GTAAAACAGGACGTGCACAC -3'

Sequencing Primer
(F):5'- GGTCTACTGAGCAACTCTGAGCATC -3'
(R):5'- GGACGTGCACACATCCTTC -3'
Posted On2018-07-24