Incidental Mutation 'R6708:Olfr203'
ID529024
Institutional Source Beutler Lab
Gene Symbol Olfr203
Ensembl Gene ENSMUSG00000068182
Gene Nameolfactory receptor 203
SynonymsMOR182-5, GA_x54KRFPKG5P-55517445-55518365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59298881-59304413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59304053 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 301 (L301Q)
Ref Sequence ENSEMBL: ENSMUSP00000086719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000215893]
Predicted Effect probably damaging
Transcript: ENSMUST00000089305
AA Change: L301Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: L301Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-46 PFAM
Pfam:7tm_1 41 290 7.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215893
AA Change: L300Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Olfr203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Olfr203 APN 16 59303633 missense probably damaging 0.99
IGL02294:Olfr203 APN 16 59303612 missense probably damaging 1.00
IGL02412:Olfr203 APN 16 59303192 missense probably damaging 1.00
IGL02899:Olfr203 APN 16 59303286 missense probably damaging 1.00
R0792:Olfr203 UTSW 16 59303989 missense probably damaging 0.99
R1551:Olfr203 UTSW 16 59303403 missense probably benign 0.03
R1701:Olfr203 UTSW 16 59303288 missense probably benign 0.23
R1975:Olfr203 UTSW 16 59303728 missense probably damaging 0.98
R2272:Olfr203 UTSW 16 59303444 missense possibly damaging 0.55
R5199:Olfr203 UTSW 16 59303740 missense probably benign
R5843:Olfr203 UTSW 16 59303361 missense probably damaging 1.00
R5928:Olfr203 UTSW 16 59303158 missense probably damaging 1.00
R6747:Olfr203 UTSW 16 59303641 missense probably benign 0.03
R6894:Olfr203 UTSW 16 59303779 missense probably damaging 0.98
R7324:Olfr203 UTSW 16 59303248 missense probably benign
R7380:Olfr203 UTSW 16 59304028 missense probably damaging 1.00
R7612:Olfr203 UTSW 16 59303627 missense probably damaging 1.00
R7775:Olfr203 UTSW 16 59303251 missense probably damaging 1.00
R8010:Olfr203 UTSW 16 59303504 missense probably damaging 1.00
Z1176:Olfr203 UTSW 16 59303169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCTCCACCTGCAG -3'
(R):5'- GTTACAAAGAGACTTAGTTGGCTG -3'

Sequencing Primer
(F):5'- CTGCAGTGCCCACCTAC -3'
(R):5'- CTTGAAATCTACCTTTAAAGTGCCC -3'
Posted On2018-07-24