Mutagenetix > Incidental Mutations

Incidental Mutation 'R6708:Olfr203'

529024

Institutional Source

Beutler Lab

Gene Symbol

Olfr203

Ensembl Gene

ENSMUSG00000068182

Gene Name

olfactory receptor 203

Synonyms

MOR182-5, GA_x54KRFPKG5P-55517445-55518365

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6708 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59298881-59304413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59304053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 301 (L301Q)

Ref Sequence

ENSEMBL: ENSMUSP00000086719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000215893]

AlphaFold

L7N205

Predicted Effect

probably damaging
Transcript: ENSMUST00000089305
AA Change: L301Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: L301Q

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1e-46	PFAM
Pfam:7tm_1	41	290	7.6e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215893
AA Change: L300Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	T	C	8: 40,796,494	L547P	probably damaging	Het
Atp8b5	T	G	4: 43,334,249	H338Q	probably benign	Het
Btbd3	A	G	2: 138,283,571	E225G	possibly damaging	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Cdh15	T	C	8: 122,863,555	I409T	probably benign	Het
Cep55	T	A	19: 38,060,261	S122T	probably benign	Het
Col5a3	G	A	9: 20,775,035	P1382L	unknown	Het
Ehmt2	A	T	17: 34,899,899	K186*	probably null	Het
Elavl2	A	T	4: 91,253,397	I295N	probably damaging	Het
Elf5	A	G	2: 103,448,989	D185G	probably damaging	Het
Emx1	A	G	6: 85,194,140	E175G	probably damaging	Het
Fan1	T	G	7: 64,372,806	N233T	probably benign	Het
Frem2	T	A	3: 53,585,501	I1865F	probably benign	Het
Kcnu1	A	G	8: 25,937,711	D352G	probably benign	Het
Klhdc1	A	T	12: 69,259,530	H247L	possibly damaging	Het
L3mbtl4	A	T	17: 68,630,258	T425S	probably benign	Het
Mrpl21	T	C	19: 3,286,890	V87A	probably damaging	Het
Olfr1423	A	T	19: 12,036,739	M1K	probably null	Het
Olfr811	G	T	10: 129,801,820	A235D	probably damaging	Het
Orc4	A	T	2: 48,937,493	H29Q	probably benign	Het
Pcnx2	C	T	8: 125,860,953		probably null	Het
Pogk	A	G	1: 166,403,509	V83A	probably damaging	Het
Synm	T	C	7: 67,733,246	E1556G	possibly damaging	Het
Tmem109	C	A	19: 10,872,031	L153F	probably damaging	Het
Ttc8	A	G	12: 98,943,532	T74A	probably damaging	Het
Zfp180	A	T	7: 24,106,096	T647S	probably damaging	Het

Other mutations in Olfr203

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02003:Olfr203	APN	16	59303633	missense	probably damaging	0.99
IGL02294:Olfr203	APN	16	59303612	missense	probably damaging	1.00
IGL02412:Olfr203	APN	16	59303192	missense	probably damaging	1.00
IGL02899:Olfr203	APN	16	59303286	missense	probably damaging	1.00
R0792:Olfr203	UTSW	16	59303989	missense	probably damaging	0.99
R1551:Olfr203	UTSW	16	59303403	missense	probably benign	0.03
R1701:Olfr203	UTSW	16	59303288	missense	probably benign	0.23
R1975:Olfr203	UTSW	16	59303728	missense	probably damaging	0.98
R2272:Olfr203	UTSW	16	59303444	missense	possibly damaging	0.55
R5199:Olfr203	UTSW	16	59303740	missense	probably benign
R5843:Olfr203	UTSW	16	59303361	missense	probably damaging	1.00
R5928:Olfr203	UTSW	16	59303158	missense	probably damaging	1.00
R6747:Olfr203	UTSW	16	59303641	missense	probably benign	0.03
R6894:Olfr203	UTSW	16	59303779	missense	probably damaging	0.98
R7324:Olfr203	UTSW	16	59303248	missense	probably benign
R7380:Olfr203	UTSW	16	59304028	missense	probably damaging	1.00
R7612:Olfr203	UTSW	16	59303627	missense	probably damaging	1.00
R7775:Olfr203	UTSW	16	59303251	missense	probably damaging	1.00
R8010:Olfr203	UTSW	16	59303504	missense	probably damaging	1.00
R8408:Olfr203	UTSW	16	59304055	nonsense	probably null
R8424:Olfr203	UTSW	16	59303409	missense	possibly damaging	0.60
R8746:Olfr203	UTSW	16	59303610	missense	probably benign	0.03
Z1176:Olfr203	UTSW	16	59303169	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAAGCCTTCTCCACCTGCAG -3'
(R):5'- GTTACAAAGAGACTTAGTTGGCTG -3'

Sequencing Primer
(F):5'- CTGCAGTGCCCACCTAC -3'
(R):5'- CTTGAAATCTACCTTTAAAGTGCCC -3'

Posted On

2018-07-24