Incidental Mutation 'R6708:Olfr1423'
ID529029
Institutional Source Beutler Lab
Gene Symbol Olfr1423
Ensembl Gene ENSMUSG00000067529
Gene Nameolfactory receptor 1423
SynonymsMOR239-3, GA_x6K02T2RE5P-2393361-2392429
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12031787-12041317 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 12036739 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000150649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087831] [ENSMUST00000214472]
Predicted Effect probably null
Transcript: ENSMUST00000087831
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085134
Gene: ENSMUSG00000067529
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 2.7e-48 PFAM
Pfam:7tm_1 41 287 2.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207831
Predicted Effect probably null
Transcript: ENSMUST00000214472
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Olfr1423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr1423 APN 19 12035941 missense probably benign 0.36
IGL01843:Olfr1423 APN 19 12036677 missense probably benign
IGL01915:Olfr1423 APN 19 12036097 missense probably damaging 1.00
IGL02283:Olfr1423 APN 19 12035855 missense possibly damaging 0.87
IGL02807:Olfr1423 APN 19 12036284 missense probably benign 0.12
IGL02976:Olfr1423 APN 19 12035973 nonsense probably null
IGL03142:Olfr1423 APN 19 12036388 missense probably damaging 1.00
R0326:Olfr1423 UTSW 19 12036161 missense probably benign 0.00
R0369:Olfr1423 UTSW 19 12036401 missense probably benign 0.01
R0614:Olfr1423 UTSW 19 12036565 missense possibly damaging 0.93
R1940:Olfr1423 UTSW 19 12035911 missense probably benign 0.06
R1978:Olfr1423 UTSW 19 12036341 missense probably benign 0.06
R2013:Olfr1423 UTSW 19 12036154 missense probably damaging 1.00
R2179:Olfr1423 UTSW 19 12036088 missense probably damaging 1.00
R3972:Olfr1423 UTSW 19 12036019 missense probably damaging 0.98
R5051:Olfr1423 UTSW 19 12035924 missense possibly damaging 0.88
R5484:Olfr1423 UTSW 19 12035828 missense probably benign 0.01
R5518:Olfr1423 UTSW 19 12036065 missense probably damaging 0.97
R5729:Olfr1423 UTSW 19 12035908 missense probably damaging 0.99
R6151:Olfr1423 UTSW 19 12036736 missense probably benign 0.00
R6723:Olfr1423 UTSW 19 12036275 missense probably damaging 1.00
R7103:Olfr1423 UTSW 19 12036388 missense probably damaging 0.99
R7385:Olfr1423 UTSW 19 12035999 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGTGCAGACGGGACTCAAAG -3'
(R):5'- AATCGGAGTAGCCAATCTAGGG -3'

Sequencing Primer
(F):5'- GACTCAAAGGTCACGATAATCATG -3'
(R):5'- GGCTCATACTACAAATATCTGAATCC -3'
Posted On2018-07-24