Incidental Mutation 'R6708:Cep55'
ID529030
Institutional Source Beutler Lab
Gene Symbol Cep55
Ensembl Gene ENSMUSG00000024989
Gene Namecentrosomal protein 55
Synonyms1200008O12Rik, 2700032M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6708 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location38055025-38074425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38060261 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 122 (S122T)
Ref Sequence ENSEMBL: ENSMUSP00000127961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096096] [ENSMUST00000116506] [ENSMUST00000169673]
Predicted Effect probably benign
Transcript: ENSMUST00000096096
AA Change: S122T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093802
Gene: ENSMUSG00000024989
AA Change: S122T

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 205 1.2e-22 PFAM
coiled coil region 229 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116506
AA Change: S122T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112205
Gene: ENSMUSG00000024989
AA Change: S122T

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 205 1.2e-22 PFAM
coiled coil region 229 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169673
AA Change: S122T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127961
Gene: ENSMUSG00000024989
AA Change: S122T

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 204 8.6e-22 PFAM
coiled coil region 229 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Mrpl21 T C 19: 3,286,890 V87A probably damaging Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Cep55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cep55 APN 19 38073439 missense probably damaging 1.00
IGL02359:Cep55 APN 19 38069868 missense probably damaging 1.00
R0079:Cep55 UTSW 19 38060321 missense probably benign 0.04
R0308:Cep55 UTSW 19 38060211 missense possibly damaging 0.94
R0377:Cep55 UTSW 19 38071889 nonsense probably null
R0725:Cep55 UTSW 19 38060174 missense possibly damaging 0.48
R0736:Cep55 UTSW 19 38073317 missense probably benign 0.21
R1842:Cep55 UTSW 19 38057900 missense probably benign 0.09
R2196:Cep55 UTSW 19 38069110 missense probably damaging 1.00
R2227:Cep55 UTSW 19 38062634 missense probably benign 0.37
R3832:Cep55 UTSW 19 38053112 unclassified probably benign
R4936:Cep55 UTSW 19 38071754 splice site probably null
R4938:Cep55 UTSW 19 38069916 missense probably damaging 1.00
R5246:Cep55 UTSW 19 38069671 missense probably benign 0.39
R5628:Cep55 UTSW 19 38069948 nonsense probably null
R5774:Cep55 UTSW 19 38062655 missense probably damaging 1.00
R6787:Cep55 UTSW 19 38057926 missense probably benign 0.01
R7047:Cep55 UTSW 19 38060091 missense possibly damaging 0.65
R7187:Cep55 UTSW 19 38060358 critical splice donor site probably null
R7473:Cep55 UTSW 19 38069936 missense probably damaging 0.99
R7762:Cep55 UTSW 19 38069069 splice site probably null
R7863:Cep55 UTSW 19 38057799 start gained probably benign
X0023:Cep55 UTSW 19 38071867 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTCTTGAAGCCGAGAGAG -3'
(R):5'- AGGTAAGTGATCTGCAGGTGC -3'

Sequencing Primer
(F):5'- AGAAAAGAATGTTTATTACCTCCTGG -3'
(R):5'- GTGCACTAACTAAGGTGTTGCATC -3'
Posted On2018-07-24