Incidental Mutation 'R6709:Slc33a1'
List |< first << previous [record 43 of 58] next >> last >|
ID529040
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Namesolute carrier family 33 (acetyl-CoA transporter), member 1
SynonymsD630022N01Rik, Acatn
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location63933507-63964768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63944701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 450 (M450I)
Ref Sequence ENSEMBL: ENSMUSP00000123986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029402
AA Change: M450I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: M450I

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160883
AA Change: M450I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: M450I

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161659
AA Change: M450I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: M450I

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Meta Mutation Damage Score 0.7256 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63964012 missense probably benign
IGL01361:Slc33a1 APN 3 63943412 missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63943347 missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63948141 missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63943332 missense probably benign
IGL02877:Slc33a1 APN 3 63943385 missense probably benign
IGL03196:Slc33a1 APN 3 63963730 missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63963757 missense probably damaging 0.98
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63953894 missense probably benign
R1513:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R1618:Slc33a1 UTSW 3 63948229 missense possibly damaging 0.66
R2038:Slc33a1 UTSW 3 63948156 missense probably damaging 1.00
R2095:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63963724 missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63963746 missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63943288 missense probably benign
R6425:Slc33a1 UTSW 3 63964063 missense probably benign
R6641:Slc33a1 UTSW 3 63953906 missense probably benign 0.09
R6866:Slc33a1 UTSW 3 63943323 missense probably benign 0.02
R7360:Slc33a1 UTSW 3 63947654 missense possibly damaging 0.87
R7768:Slc33a1 UTSW 3 63947618 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACTCGTGGTATGGGAGAATGTC -3'
(R):5'- CACCCCTGTGCTTAATTCTGAATAC -3'

Sequencing Primer
(F):5'- GGAGAATGTCTTCCTTTGCTAAGAAG -3'
(R):5'- TGTGCTTAATTCTGAATACTCTTCC -3'
Posted On2018-07-24