Incidental Mutation 'R6709:Mlxip'
ID529047
Institutional Source Beutler Lab
Gene Symbol Mlxip
Ensembl Gene ENSMUSG00000038342
Gene NameMLX interacting protein
SynonymsMondoa, bHLHe36, Mir
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123394798-123457932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123447276 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 616 (I616F)
Ref Sequence ENSEMBL: ENSMUSP00000064943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068237] [ENSMUST00000111596]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068237
AA Change: I616F

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064943
Gene: ENSMUSG00000038342
AA Change: I616F

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 27 44 N/A INTRINSIC
low complexity region 47 73 N/A INTRINSIC
PDB:4GNT|B 157 177 8e-7 PDB
low complexity region 347 363 N/A INTRINSIC
low complexity region 436 467 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 557 570 N/A INTRINSIC
low complexity region 632 643 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
HLH 723 773 2.81e-9 SMART
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111596
SMART Domains Protein: ENSMUSP00000107223
Gene: ENSMUSG00000038342

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 27 44 N/A INTRINSIC
low complexity region 47 73 N/A INTRINSIC
PDB:4GNT|B 157 177 6e-7 PDB
low complexity region 347 363 N/A INTRINSIC
low complexity region 436 467 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 557 570 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135961
AA Change: I61F
SMART Domains Protein: ENSMUSP00000120510
Gene: ENSMUSG00000038342
AA Change: I61F

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 132 150 N/A INTRINSIC
HLH 169 219 2.81e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199458
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as part of a heterodimer to activate transcription. The encoded protein forms a heterodimer with Max-like protein X (MLX) and is involved in the regulation of genes in response to cellular glucose levels. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Mlxip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Mlxip APN 5 123447205 missense probably benign 0.35
IGL00922:Mlxip APN 5 123440065 missense probably damaging 1.00
IGL01138:Mlxip APN 5 123450156 missense probably damaging 1.00
IGL01624:Mlxip APN 5 123395329 missense probably benign 0.08
IGL02155:Mlxip APN 5 123453392 missense probably benign
IGL03011:Mlxip APN 5 123445951 missense probably benign 0.01
IGL03177:Mlxip APN 5 123445981 missense possibly damaging 0.86
IGL03242:Mlxip APN 5 123440061 missense probably damaging 1.00
PIT4366001:Mlxip UTSW 5 123395110 missense probably benign 0.00
R0136:Mlxip UTSW 5 123442306 missense probably damaging 1.00
R1583:Mlxip UTSW 5 123450223 missense possibly damaging 0.86
R2410:Mlxip UTSW 5 123443069 missense probably damaging 1.00
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2870:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2870:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2871:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2871:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2873:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2962:Mlxip UTSW 5 123440824 missense probably damaging 0.99
R3709:Mlxip UTSW 5 123447474 missense probably benign 0.00
R4512:Mlxip UTSW 5 123395065 missense probably benign
R4536:Mlxip UTSW 5 123450503 missense probably damaging 0.97
R4722:Mlxip UTSW 5 123447202 missense probably benign 0.39
R4993:Mlxip UTSW 5 123395294 missense probably damaging 1.00
R5503:Mlxip UTSW 5 123395327 missense probably damaging 0.98
R5715:Mlxip UTSW 5 123440058 missense probably damaging 1.00
R6006:Mlxip UTSW 5 123445658 missense possibly damaging 0.93
R6330:Mlxip UTSW 5 123394952 missense probably benign
R6617:Mlxip UTSW 5 123442449 intron probably null
R6970:Mlxip UTSW 5 123445672 missense possibly damaging 0.52
R7718:Mlxip UTSW 5 123445514 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACCACATGCTTCACCAG -3'
(R):5'- TCTTGCACTGTACTTGGAGAAAAG -3'

Sequencing Primer
(F):5'- GCTGGCTGCAGCTTATGAG -3'
(R):5'- CACTGTACTTGGAGAAAAGAGTCG -3'
Posted On2018-07-24