Incidental Mutation 'R6709:Actl6b'
ID529048
Institutional Source Beutler Lab
Gene Symbol Actl6b
Ensembl Gene ENSMUSG00000029712
Gene Nameactin-like 6B
SynonymsActl6, ArpNa, Baf53b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137553517-137569582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137554517 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 36 (D36G)
Ref Sequence ENSEMBL: ENSMUSP00000031725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000125489] [ENSMUST00000136088] [ENSMUST00000136565] [ENSMUST00000139395] [ENSMUST00000149292] [ENSMUST00000198601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031725
AA Change: D36G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712
AA Change: D36G

DomainStartEndE-ValueType
ACTIN 11 379 4.16e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125489
Predicted Effect probably benign
Transcript: ENSMUST00000136088
SMART Domains Protein: ENSMUSP00000117138
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 75 4.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136565
SMART Domains Protein: ENSMUSP00000117425
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 116 1.3e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139395
AA Change: D36G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712
AA Change: D36G

DomainStartEndE-ValueType
ACTIN 11 426 5.96e-167 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145500
Predicted Effect probably benign
Transcript: ENSMUST00000149292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196154
Predicted Effect probably benign
Transcript: ENSMUST00000198601
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for null mutations exhibit low survivor rate and most die within 2 days after birth and show hyperactivity due to reduced dendrite formation in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Actl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Actl6b APN 5 137554637 missense probably damaging 0.99
IGL03271:Actl6b APN 5 137565984 missense probably damaging 1.00
R0128:Actl6b UTSW 5 137555065 missense probably benign
R0254:Actl6b UTSW 5 137554144 intron probably benign
R0571:Actl6b UTSW 5 137566784 unclassified probably benign
R1438:Actl6b UTSW 5 137554609 missense probably damaging 0.99
R1530:Actl6b UTSW 5 137569378 missense probably damaging 1.00
R1621:Actl6b UTSW 5 137565779 missense probably benign 0.18
R2008:Actl6b UTSW 5 137569330 missense probably damaging 1.00
R2907:Actl6b UTSW 5 137567297 missense probably damaging 1.00
R3826:Actl6b UTSW 5 137567273 missense probably damaging 0.99
R5326:Actl6b UTSW 5 137567051 missense probably damaging 1.00
R5763:Actl6b UTSW 5 137566801 missense possibly damaging 0.49
R5906:Actl6b UTSW 5 137567329 missense possibly damaging 0.95
R5972:Actl6b UTSW 5 137566556 missense possibly damaging 0.55
R7134:Actl6b UTSW 5 137564500 missense probably damaging 0.96
R7249:Actl6b UTSW 5 137555085 missense probably damaging 0.99
X0065:Actl6b UTSW 5 137565737 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTGCAATTGAACCAGGGACTAGC -3'
(R):5'- TGAGGGTCCCTTACTCATGC -3'

Sequencing Primer
(F):5'- CAGGGTAGTGCGTTCCTTTAAATCC -3'
(R):5'- ACTCATGCCATTCTTGAGGGGC -3'
Posted On2018-07-24