Incidental Mutation 'R6709:Syngr4'
ID529058
Institutional Source Beutler Lab
Gene Symbol Syngr4
Ensembl Gene ENSMUSG00000040231
Gene Namesynaptogyrin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45885222-45896714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45888698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000113955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002855] [ENSMUST00000039049] [ENSMUST00000120299] [ENSMUST00000211716]
Predicted Effect probably benign
Transcript: ENSMUST00000002855
SMART Domains Protein: ENSMUSP00000002855
Gene: ENSMUSG00000002778

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:ER_lumen_recept 28 169 7.5e-58 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039049
AA Change: V82A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047035
Gene: ENSMUSG00000040231
AA Change: V82A

DomainStartEndE-ValueType
Pfam:MARVEL 18 163 2e-27 PFAM
low complexity region 184 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120299
AA Change: V82A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113955
Gene: ENSMUSG00000040231
AA Change: V82A

DomainStartEndE-ValueType
Pfam:MARVEL 18 110 2.3e-12 PFAM
low complexity region 113 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211254
Predicted Effect probably benign
Transcript: ENSMUST00000211716
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein. The gene belongs to the synaptogyrin gene family. Like other members of the family the protein contains four transmembrane regions. The exact function of this protein is unclear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Syngr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Syngr4 APN 7 45886966 missense probably benign
R1739:Syngr4 UTSW 7 45888722 missense possibly damaging 0.95
R2143:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2144:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2145:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R3740:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R3741:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R3742:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R4627:Syngr4 UTSW 7 45887028 missense probably damaging 1.00
R6767:Syngr4 UTSW 7 45887491 missense possibly damaging 0.58
R7207:Syngr4 UTSW 7 45888677 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GACAAGGACCAGAAGATGCTTC -3'
(R):5'- CCTTTCCATTGTGGTTCACAGG -3'

Sequencing Primer
(F):5'- ATGCTTCCAGGAGGAGTCATC -3'
(R):5'- ATTGTGGTTCACAGGTCTTTTCC -3'
Posted On2018-07-24