Incidental Mutation 'R6709:Olfm2'
ID529064
Institutional Source Beutler Lab
Gene Symbol Olfm2
Ensembl Gene ENSMUSG00000032172
Gene Nameolfactomedin 2
SynonymsA030009A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6709 (G1)
Quality Score206.009
Status Validated
Chromosome9
Chromosomal Location20667690-20746349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20672713 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 116 (Y116H)
Ref Sequence ENSEMBL: ENSMUSP00000151018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034692] [ENSMUST00000215999] [ENSMUST00000217198]
Predicted Effect probably damaging
Transcript: ENSMUST00000034692
AA Change: Y86H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034692
Gene: ENSMUSG00000032172
AA Change: Y86H

DomainStartEndE-ValueType
Pfam:Noelin-1 19 118 3.8e-44 PFAM
Blast:OLF 132 177 2e-18 BLAST
OLF 190 440 4.32e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215039
Predicted Effect possibly damaging
Transcript: ENSMUST00000215999
AA Change: Y94H

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000217198
AA Change: Y116H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate locomotor and anxiety-related behavioral abnormalities, altered visual evoked potential, and reduced compactness of myelin sheaths in the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Olfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Olfm2 APN 9 20672180 missense probably damaging 1.00
IGL03276:Olfm2 APN 9 20668787 splice site probably benign
IGL03352:Olfm2 APN 9 20668723 missense probably damaging 1.00
R0015:Olfm2 UTSW 9 20668741 missense probably damaging 1.00
R0847:Olfm2 UTSW 9 20668657 missense probably damaging 1.00
R1051:Olfm2 UTSW 9 20668463 missense probably damaging 1.00
R3730:Olfm2 UTSW 9 20672767 missense probably damaging 1.00
R5366:Olfm2 UTSW 9 20668412 missense probably benign 0.04
R5665:Olfm2 UTSW 9 20668544 unclassified probably null
R5986:Olfm2 UTSW 9 20675650 missense probably damaging 1.00
R6046:Olfm2 UTSW 9 20668528 missense probably damaging 1.00
R7020:Olfm2 UTSW 9 20668568 missense probably damaging 1.00
R7636:Olfm2 UTSW 9 20668297 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CATTTCTTCCCAGACGTGGC -3'
(R):5'- GTTGCCAGTGAGATCAGAGG -3'

Sequencing Primer
(F):5'- CTTGGAACTCAGGTCCTCTGG -3'
(R):5'- TTGCCAGTGAGATCAGAGGAGAATAG -3'
Posted On2018-07-24