Incidental Mutation 'R6709:Trdn'
ID529068
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Nametriadin
Synonymstriadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location33080554-33476709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33464591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 607 (D607G)
Ref Sequence ENSEMBL: ENSMUSP00000093436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
Predicted Effect probably benign
Transcript: ENSMUST00000095762
AA Change: D607G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: D607G

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218168
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33471606 critical splice donor site probably null
IGL01310:Trdn APN 10 33305098 splice site probably benign
IGL01313:Trdn APN 10 33200220 missense probably damaging 1.00
IGL02177:Trdn APN 10 33139173 missense probably damaging 1.00
IGL02631:Trdn APN 10 33363976 critical splice acceptor site probably null
IGL02732:Trdn APN 10 33468199 splice site probably null
IGL03131:Trdn APN 10 33398414 nonsense probably null
Button UTSW 10 33474453 missense probably damaging 0.97
R0463:Trdn UTSW 10 33466421 critical splice acceptor site probably null
R0610:Trdn UTSW 10 33474453 missense probably damaging 0.97
R0786:Trdn UTSW 10 33305081 missense probably benign 0.22
R0827:Trdn UTSW 10 33399158 splice site probably benign
R1511:Trdn UTSW 10 33466452 missense probably benign 0.18
R1623:Trdn UTSW 10 33258102 missense possibly damaging 0.82
R1760:Trdn UTSW 10 33233887 missense possibly damaging 0.92
R1766:Trdn UTSW 10 33364008 missense probably damaging 1.00
R1884:Trdn UTSW 10 33257095 missense probably benign 0.38
R2297:Trdn UTSW 10 33335012 missense probably damaging 1.00
R2396:Trdn UTSW 10 33195982 missense probably damaging 1.00
R3436:Trdn UTSW 10 33468195 critical splice donor site probably null
R3686:Trdn UTSW 10 33468189 missense probably benign 0.20
R3696:Trdn UTSW 10 33305032 splice site probably null
R3701:Trdn UTSW 10 33334984 missense probably damaging 0.99
R3712:Trdn UTSW 10 33157166 missense probably benign 0.03
R4062:Trdn UTSW 10 33257087 missense probably benign 0.05
R4249:Trdn UTSW 10 33450998 missense probably benign 0.09
R4289:Trdn UTSW 10 33464582 missense probably benign 0.00
R4646:Trdn UTSW 10 33195981 nonsense probably null
R4647:Trdn UTSW 10 33195981 nonsense probably null
R4648:Trdn UTSW 10 33195981 nonsense probably null
R4766:Trdn UTSW 10 33474506 missense probably benign 0.04
R4776:Trdn UTSW 10 33399082 splice site probably null
R4880:Trdn UTSW 10 33471579 missense probably benign 0.26
R4898:Trdn UTSW 10 33474417 missense probably damaging 0.96
R5017:Trdn UTSW 10 33468159 missense probably benign 0.05
R5300:Trdn UTSW 10 33195982 missense probably damaging 1.00
R5320:Trdn UTSW 10 33333251 critical splice donor site probably null
R6089:Trdn UTSW 10 33464575 missense probably benign 0.01
R6216:Trdn UTSW 10 33305069 missense probably damaging 1.00
R6431:Trdn UTSW 10 33139114 missense probably damaging 1.00
R6475:Trdn UTSW 10 33464555 splice site probably null
R6501:Trdn UTSW 10 33466454 missense probably benign 0.02
R6662:Trdn UTSW 10 33474487 missense probably damaging 0.98
R6783:Trdn UTSW 10 33438815 missense probably damaging 0.96
R6906:Trdn UTSW 10 33233948 missense probably benign
R6916:Trdn UTSW 10 33157018 missense probably damaging 1.00
R7291:Trdn UTSW 10 33437736 missense probably null 0.83
R7499:Trdn UTSW 10 33196101 missense probably benign
R7601:Trdn UTSW 10 33196156 missense probably benign 0.00
R7743:Trdn UTSW 10 33257062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTCTCCTTTGCAAATCATG -3'
(R):5'- GTTTCTCCCTTTATGAGAGGGC -3'

Sequencing Primer
(F):5'- AGAGACCTCTAACTGCCC -3'
(R):5'- TCCCTTTATGAGAGGGCTTTTAC -3'
Posted On2018-07-24