Incidental Mutation 'R6709:Olfr328'
ID529070
Institutional Source Beutler Lab
Gene Symbol Olfr328
Ensembl Gene ENSMUSG00000057654
Gene Nameolfactory receptor 328
SynonymsMOR275-2, GA_x6K02T2NKPP-873285-874217
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58550854-58555636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58552036 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 68 (M68V)
Ref Sequence ENSEMBL: ENSMUSP00000150086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073933] [ENSMUST00000108824] [ENSMUST00000215717] [ENSMUST00000216725]
Predicted Effect probably benign
Transcript: ENSMUST00000073933
AA Change: M68V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073588
Gene: ENSMUSG00000057654
AA Change: M68V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 34 303 8.3e-6 PFAM
Pfam:7tm_1 40 289 1.4e-34 PFAM
Pfam:7tm_4 138 282 4.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108824
AA Change: M68V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104452
Gene: ENSMUSG00000057654
AA Change: M68V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 303 8.3e-6 PFAM
Pfam:7tm_1 40 289 9.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215717
AA Change: M68V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216725
AA Change: M68V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.2527 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Olfr328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Olfr328 APN 11 58551734 nonsense probably null
IGL02887:Olfr328 APN 11 58552161 missense probably damaging 1.00
IGL03409:Olfr328 APN 11 58551562 missense probably benign 0.01
P4748:Olfr328 UTSW 11 58551522 missense probably damaging 1.00
R0504:Olfr328 UTSW 11 58551636 missense probably damaging 1.00
R1637:Olfr328 UTSW 11 58551420 missense possibly damaging 0.64
R1863:Olfr328 UTSW 11 58552023 missense probably benign 0.04
R2158:Olfr328 UTSW 11 58551942 missense probably damaging 1.00
R2404:Olfr328 UTSW 11 58551720 missense probably damaging 1.00
R4024:Olfr328 UTSW 11 58551396 missense possibly damaging 0.90
R4073:Olfr328 UTSW 11 58552062 missense probably damaging 1.00
R5261:Olfr328 UTSW 11 58552051 missense probably benign 0.01
R5399:Olfr328 UTSW 11 58552143 missense probably benign 0.20
R6053:Olfr328 UTSW 11 58552066 missense possibly damaging 0.90
R6411:Olfr328 UTSW 11 58551657 missense probably damaging 0.99
R7243:Olfr328 UTSW 11 58551401 missense probably damaging 1.00
R7540:Olfr328 UTSW 11 58551631 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGTGGTTCATGAGGACAGG -3'
(R):5'- ACTGGACAATTTTCAGATTTCACCC -3'

Sequencing Primer
(F):5'- CTGTGGTTCATGAGGACAGGATACC -3'
(R):5'- GACAATTTTCAGATTTCACCCTGGTG -3'
Posted On2018-07-24