Mutagenetix > Incidental Mutations

Incidental Mutation 'R6709:Actn1'

529073

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.437) question?

Stock #

R6709 (G1)

Quality Score

111.008

Status

Validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80193644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 223 (D223V)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

AlphaFold

Q7TPR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000021554
AA Change: D223V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: D223V

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167327
AA Change: D223V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: D223V

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220316

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220351

Meta Mutation Damage Score

0.9688

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,554,517	D36G	possibly damaging	Het
Adgre1	A	T	17: 57,406,917	N201Y	probably benign	Het
Agbl4	T	A	4: 111,566,782		probably benign	Het
Atg4d	T	C	9: 21,268,648	Y272H	probably damaging	Het
Ccdc39	T	C	3: 33,830,093	T367A	possibly damaging	Het
Ceacam2	T	C	7: 25,529,837	T293A	possibly damaging	Het
Col19a1	C	T	1: 24,282,496	G977E	probably damaging	Het
Csnka2ip	A	T	16: 64,478,569	H33Q	possibly damaging	Het
Cyp3a44	A	T	5: 145,778,092		probably null	Het
Dcpp3	AGGCCATGCTGGCC	AGGCC	17: 23,917,598		probably benign	Het
Dnah12	A	G	14: 26,872,749	D3492G	probably damaging	Het
Eepd1	A	T	9: 25,482,868	T143S	probably benign	Het
Eml2	A	G	7: 19,206,211	*650W	probably null	Het
Etv1	C	T	12: 38,783,797	T19I	possibly damaging	Het
Fam133b	T	C	5: 3,569,059		probably benign	Het
Fgd4	T	C	16: 16,484,481	H70R	probably benign	Het
Galnt11	C	T	5: 25,248,853	R26C	probably damaging	Het
Gm136	T	A	4: 34,755,884	Y43F	probably damaging	Het
Gm17409	A	T	2: 58,471,076		probably null	Het
Gm5591	A	G	7: 38,522,075	I190T	probably benign	Het
Hils1	T	A	11: 94,967,946	S22R	possibly damaging	Het
Htra1	C	T	7: 130,936,218		probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ints8	A	T	4: 11,221,117	Y753N	possibly damaging	Het
L3mbtl3	G	A	10: 26,282,797	T651I	unknown	Het
Ltb4r2	A	C	14: 55,762,533	T204P	possibly damaging	Het
Ltbp3	G	A	19: 5,747,857		probably null	Het
Mlxip	A	T	5: 123,447,276	I616F	possibly damaging	Het
Mpz	A	T	1: 171,150,732		probably benign	Het
Myh11	A	G	16: 14,223,494		probably null	Het
Myo7a	A	G	7: 98,054,699	L1949P	probably damaging	Het
Olfm2	A	G	9: 20,672,713	Y116H	probably damaging	Het
Olfr328	T	C	11: 58,552,036	M68V	probably benign	Het
Olfr750	A	T	14: 51,070,829	L188H	probably damaging	Het
Pde4d	T	G	13: 109,948,279	L470R	probably damaging	Het
Plxna2	T	A	1: 194,789,766	N1013K	probably benign	Het
Ptpn13	A	C	5: 103,586,756	Q2118P	probably benign	Het
Pwwp2a	C	G	11: 43,704,727	L240V	probably damaging	Het
Reep2	T	C	18: 34,846,210	L196P	probably benign	Het
Shank1	A	T	7: 44,354,176	N1765I	probably benign	Het
Slc25a13	A	G	6: 6,073,440	S473P	possibly damaging	Het
Slc33a1	C	A	3: 63,944,701	M450I	possibly damaging	Het
Slc45a2	A	G	15: 11,001,130	Y105C	possibly damaging	Het
Slc4a11	A	T	2: 130,684,696	L812Q	probably damaging	Het
Sox6	T	C	7: 115,701,789		probably null	Het
Ssfa2	A	G	2: 79,644,932	T412A	probably benign	Het
Sv2b	A	T	7: 75,124,139	M528K	probably benign	Het
Syngr4	A	G	7: 45,888,698	V82A	probably benign	Het
Tmem185b	G	A	1: 119,526,874	V122I	probably benign	Het
Trdn	A	G	10: 33,464,591	D607G	probably benign	Het
Trim10	T	A	17: 36,872,370	I186N	probably damaging	Het
Trp53i11	A	T	2: 93,199,818	M157L	probably benign	Het
Ubr3	C	A	2: 70,013,092	H1559N	probably damaging	Het
Usp25	A	C	16: 77,083,932	E727A	probably benign	Het
Vmn2r42	T	A	7: 8,192,619	R509S	probably benign	Het
Vmn2r69	T	C	7: 85,411,861	N172D	probably benign	Het
Zfp14	T	C	7: 30,038,132	Y476C	probably damaging	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00
R9237:Actn1	UTSW	12	80193696	missense	possibly damaging	0.92
R9269:Actn1	UTSW	12	80172971	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAAACTTGCTCTATGCTGCTTGC -3'
(R):5'- CTAGAACCTGAGAAGGGCTG -3'

Sequencing Primer
(F):5'- CGTGCTGTCAGCTAGTGC -3'
(R):5'- CCTGAGAAGGGCTGGTACACAC -3'

Posted On

2018-07-24