Incidental Mutation 'R6709:Myh11'
ID529078
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
MMRRC Submission
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 14223494 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably null
Transcript: ENSMUST00000090287
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000230397
Predicted Effect probably null
Transcript: ENSMUST00000231567
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
R7644:Myh11 UTSW 16 14221824 missense
R7838:Myh11 UTSW 16 14209617 missense
R7905:Myh11 UTSW 16 14207681 nonsense probably null
R7921:Myh11 UTSW 16 14209617 missense
R7988:Myh11 UTSW 16 14207681 nonsense probably null
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Z1176:Myh11 UTSW 16 14239396 missense probably null
Z1176:Myh11 UTSW 16 14277775 missense
Z1177:Myh11 UTSW 16 14209595 missense
Predicted Primers PCR Primer
(F):5'- ACATGCATTGCAGTTGAACTTC -3'
(R):5'- CCACTGACTAAATGGCCCAG -3'

Sequencing Primer
(F):5'- AACTTCCTTTTTCTCTCATGCAGAAG -3'
(R):5'- GTTGAAAATGGAAACCCTTCTTCCTC -3'
Posted On2018-07-24