Incidental Mutation 'R6709:Csnka2ip'
ID529080
Institutional Source Beutler Lab
Gene Symbol Csnka2ip
Ensembl Gene ENSMUSG00000068167
Gene Namecasein kinase 2, alpha prime interacting protein
SynonymsCkt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location64477810-64602408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64478569 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 33 (H33Q)
Ref Sequence ENSEMBL: ENSMUSP00000086692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089279] [ENSMUST00000209382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089279
AA Change: H33Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086692
Gene: ENSMUSG00000068167
AA Change: H33Q

DomainStartEndE-ValueType
low complexity region 164 182 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209382
AA Change: H477Q
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Csnka2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Csnka2ip APN 16 64478594 missense probably damaging 0.99
IGL02677:Csnka2ip APN 16 64478312 missense probably damaging 0.99
R0593:Csnka2ip UTSW 16 64478612 missense probably damaging 0.99
R1075:Csnka2ip UTSW 16 64477947 nonsense probably null
R1698:Csnka2ip UTSW 16 64478059 nonsense probably null
R1815:Csnka2ip UTSW 16 64478492 missense probably benign
R6446:Csnka2ip UTSW 16 64479381 nonsense probably null
R6937:Csnka2ip UTSW 16 64478695 utr 5 prime probably benign
R6999:Csnka2ip UTSW 16 64478570 missense unknown
R7013:Csnka2ip UTSW 16 64478417 missense unknown
R7103:Csnka2ip UTSW 16 64478757 missense unknown
R7395:Csnka2ip UTSW 16 64479440 missense
Predicted Primers PCR Primer
(F):5'- CAGATTGTCATCGAGGGCTTC -3'
(R):5'- TGCATTATTAAAGGCGGTAGTGTTC -3'

Sequencing Primer
(F):5'- TCGAGGGCTTCTAAATTATTTTCAG -3'
(R):5'- ATTAAAGGCGGTAGTGTTCCTGTTG -3'
Posted On2018-07-24