Incidental Mutation 'R6709:Ltbp3'
ID529086
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 5747857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081496]
Predicted Effect probably null
Transcript: ENSMUST00000081496
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc25a13 A G 6: 6,073,440 S473P possibly damaging Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTTCAAGGAGATCTGCC -3'
(R):5'- AGGCTAGGGATTTACATGTTAGAG -3'

Sequencing Primer
(F):5'- AAGGAGATCTGCCCGGCTG -3'
(R):5'- GCAGGATATCTGATATGTGACACCC -3'
Posted On2018-07-24