Incidental Mutation 'R6710:Sem1'
ID529091
Institutional Source Beutler Lab
Gene Symbol Sem1
Ensembl Gene ENSMUSG00000042541
Gene NameSEM1, 26S proteasome complex subunit
SynonymsShfdg1, Shfg, Shfm1, DSS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6710 (G1)
Quality Score208.009
Status Not validated
Chromosome6
Chromosomal Location6557294-6578663 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 6578497 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 20 (E20*)
Ref Sequence ENSEMBL: ENSMUSP00000040741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041111]
Predicted Effect probably null
Transcript: ENSMUST00000041111
AA Change: E20*
SMART Domains Protein: ENSMUSP00000040741
Gene: ENSMUSG00000042541
AA Change: E20*

DomainStartEndE-ValueType
DSS1_SEM1 5 62 1.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205180
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,226,061 E124D probably benign Het
Aph1c T C 9: 66,834,520 T27A probably benign Het
Ash2l T C 8: 25,819,712 I507V possibly damaging Het
Cela2a C A 4: 141,822,243 A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Drc1 A G 5: 30,363,085 D590G possibly damaging Het
Epn1 A G 7: 5,097,304 E472G probably damaging Het
Erfe A G 1: 91,372,406 D318G probably damaging Het
Ifnar2 T C 16: 91,393,883 C227R probably damaging Het
March11 A G 15: 26,387,863 Y268C probably damaging Het
Muc16 A T 9: 18,642,070 I4309N possibly damaging Het
Nit2 A G 16: 57,160,130 V95A possibly damaging Het
Nup205 T G 6: 35,247,373 I2049S probably benign Het
Olfr869 C T 9: 20,138,082 A322V probably benign Het
Olfr91 T G 17: 37,093,746 I43L probably damaging Het
Pcdhb17 T C 18: 37,485,399 S81P probably damaging Het
Plcg2 A G 8: 117,557,347 I128V probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Tmem26 T C 10: 68,724,054 L52P probably damaging Het
Utp3 T C 5: 88,555,964 Y451H probably damaging Het
Vmn2r103 T A 17: 19,811,977 I671N probably damaging Het
Zbtb39 T A 10: 127,743,636 I693N probably damaging Het
Zfp174 A G 16: 3,848,057 E62G probably damaging Het
Other mutations in Sem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1365:Sem1 UTSW 6 6560501 missense possibly damaging 0.92
R3615:Sem1 UTSW 6 6578520 missense probably damaging 0.98
R3616:Sem1 UTSW 6 6578520 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGAAGTTAAAGGGCCACAAGC -3'
(R):5'- ACGGGAGGACCTACTACAAC -3'

Sequencing Primer
(F):5'- TGGTTCCTCCCAGCGAC -3'
(R):5'- TCTGGGAGGACCTTCGCTG -3'
Posted On2018-07-24