Incidental Mutation 'R6710:Olfr869'
ID529097
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6710 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20138082 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 322 (A322V)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075717] [ENSMUST00000213024]
Predicted Effect probably benign
Transcript: ENSMUST00000075717
AA Change: A322V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: A322V

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213024
AA Change: A322V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,226,061 E124D probably benign Het
Aph1c T C 9: 66,834,520 T27A probably benign Het
Ash2l T C 8: 25,819,712 I507V possibly damaging Het
Cela2a C A 4: 141,822,243 A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Drc1 A G 5: 30,363,085 D590G possibly damaging Het
Epn1 A G 7: 5,097,304 E472G probably damaging Het
Erfe A G 1: 91,372,406 D318G probably damaging Het
Ifnar2 T C 16: 91,393,883 C227R probably damaging Het
March11 A G 15: 26,387,863 Y268C probably damaging Het
Muc16 A T 9: 18,642,070 I4309N possibly damaging Het
Nit2 A G 16: 57,160,130 V95A possibly damaging Het
Nup205 T G 6: 35,247,373 I2049S probably benign Het
Olfr91 T G 17: 37,093,746 I43L probably damaging Het
Pcdhb17 T C 18: 37,485,399 S81P probably damaging Het
Plcg2 A G 8: 117,557,347 I128V probably benign Het
Sem1 C A 6: 6,578,497 E20* probably null Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Tmem26 T C 10: 68,724,054 L52P probably damaging Het
Utp3 T C 5: 88,555,964 Y451H probably damaging Het
Vmn2r103 T A 17: 19,811,977 I671N probably damaging Het
Zbtb39 T A 10: 127,743,636 I693N probably damaging Het
Zfp174 A G 16: 3,848,057 E62G probably damaging Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4588:Olfr869 UTSW 9 20138087 makesense probably null
R4931:Olfr869 UTSW 9 20137562 missense probably benign 0.19
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R5780:Olfr869 UTSW 9 20137497 missense probably damaging 0.98
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6599:Olfr869 UTSW 9 20137943 missense probably damaging 1.00
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
R7585:Olfr869 UTSW 9 20129011
R7860:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R7943:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R8025:Olfr869 UTSW 9 20137632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCTTTTCTACCTGTGGG -3'
(R):5'- ATGGATGGTGAACTCGAGTG -3'

Sequencing Primer
(F):5'- CTGTGGGTCTCACCTGTCAG -3'
(R):5'- GTAGTAGAATGAAAGCCACA -3'
Posted On2018-07-24