Incidental Mutation 'R6710:Tmem26'
ID529099
Institutional Source Beutler Lab
Gene Symbol Tmem26
Ensembl Gene ENSMUSG00000060044
Gene Nametransmembrane protein 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6710 (G1)
Quality Score185.009
Status Not validated
Chromosome10
Chromosomal Location68723646-68782650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68724054 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 52 (L52P)
Ref Sequence ENSEMBL: ENSMUSP00000079789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080995] [ENSMUST00000218918] [ENSMUST00000219392]
Predicted Effect probably damaging
Transcript: ENSMUST00000080995
AA Change: L52P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079789
Gene: ENSMUSG00000060044
AA Change: L52P

DomainStartEndE-ValueType
Pfam:Tmem26 3 304 5.6e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218918
AA Change: L52P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219392
AA Change: L52P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,226,061 E124D probably benign Het
Aph1c T C 9: 66,834,520 T27A probably benign Het
Ash2l T C 8: 25,819,712 I507V possibly damaging Het
Cela2a C A 4: 141,822,243 A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Drc1 A G 5: 30,363,085 D590G possibly damaging Het
Epn1 A G 7: 5,097,304 E472G probably damaging Het
Erfe A G 1: 91,372,406 D318G probably damaging Het
Ifnar2 T C 16: 91,393,883 C227R probably damaging Het
March11 A G 15: 26,387,863 Y268C probably damaging Het
Muc16 A T 9: 18,642,070 I4309N possibly damaging Het
Nit2 A G 16: 57,160,130 V95A possibly damaging Het
Nup205 T G 6: 35,247,373 I2049S probably benign Het
Olfr869 C T 9: 20,138,082 A322V probably benign Het
Olfr91 T G 17: 37,093,746 I43L probably damaging Het
Pcdhb17 T C 18: 37,485,399 S81P probably damaging Het
Plcg2 A G 8: 117,557,347 I128V probably benign Het
Sem1 C A 6: 6,578,497 E20* probably null Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Utp3 T C 5: 88,555,964 Y451H probably damaging Het
Vmn2r103 T A 17: 19,811,977 I671N probably damaging Het
Zbtb39 T A 10: 127,743,636 I693N probably damaging Het
Zfp174 A G 16: 3,848,057 E62G probably damaging Het
Other mutations in Tmem26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmem26 APN 10 68775354 missense probably damaging 1.00
IGL00471:Tmem26 APN 10 68778681 missense possibly damaging 0.78
IGL01301:Tmem26 APN 10 68778606 missense probably damaging 1.00
IGL01567:Tmem26 APN 10 68751231 missense probably damaging 1.00
IGL02487:Tmem26 APN 10 68778733 missense probably benign 0.00
IGL02713:Tmem26 APN 10 68751295 missense probably damaging 1.00
IGL02828:Tmem26 APN 10 68775385 critical splice donor site probably null
ANU18:Tmem26 UTSW 10 68778606 missense probably damaging 1.00
P0027:Tmem26 UTSW 10 68778718 missense probably benign 0.00
R1415:Tmem26 UTSW 10 68778661 missense possibly damaging 0.93
R1649:Tmem26 UTSW 10 68751273 missense probably damaging 1.00
R3871:Tmem26 UTSW 10 68778732 missense probably benign 0.01
R5072:Tmem26 UTSW 10 68775348 missense probably damaging 1.00
R5239:Tmem26 UTSW 10 68751266 missense probably damaging 0.97
R6053:Tmem26 UTSW 10 68748484 missense probably benign 0.00
R6607:Tmem26 UTSW 10 68778713 missense probably benign 0.00
R7378:Tmem26 UTSW 10 68724092 critical splice donor site probably null
T0722:Tmem26 UTSW 10 68778718 missense probably benign 0.00
X0003:Tmem26 UTSW 10 68778718 missense probably benign 0.00
Z1177:Tmem26 UTSW 10 68723963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACTCGGGCTGGCAATC -3'
(R):5'- GATGCATCGGTATCCCATGTGC -3'

Sequencing Primer
(F):5'- AATCACAGTCCCAGGGGTGTC -3'
(R):5'- GTATCCCATGTGCCGACC -3'
Posted On2018-07-24