Incidental Mutation 'R6710:Vmn2r103'
ID 529106
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 044828-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20032239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 671 (I671N)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: I671N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I671N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,061,923 (GRCm39) E124D probably benign Het
Aph1c T C 9: 66,741,802 (GRCm39) T27A probably benign Het
Ash2l T C 8: 26,309,740 (GRCm39) I507V possibly damaging Het
Cela2a C A 4: 141,549,554 (GRCm39) A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 24,136,572 (GRCm39) probably benign Het
Drc1 A G 5: 30,520,429 (GRCm39) D590G possibly damaging Het
Epn1 A G 7: 5,100,303 (GRCm39) E472G probably damaging Het
Erfe A G 1: 91,300,128 (GRCm39) D318G probably damaging Het
Ifnar2 T C 16: 91,190,771 (GRCm39) C227R probably damaging Het
Marchf11 A G 15: 26,387,949 (GRCm39) Y268C probably damaging Het
Muc16 A T 9: 18,553,366 (GRCm39) I4309N possibly damaging Het
Nit2 A G 16: 56,980,493 (GRCm39) V95A possibly damaging Het
Nup205 T G 6: 35,224,308 (GRCm39) I2049S probably benign Het
Or2h1 T G 17: 37,404,638 (GRCm39) I43L probably damaging Het
Or7e175 C T 9: 20,049,378 (GRCm39) A322V probably benign Het
Pcdhb17 T C 18: 37,618,452 (GRCm39) S81P probably damaging Het
Plcg2 A G 8: 118,284,086 (GRCm39) I128V probably benign Het
Sem1 C A 6: 6,578,497 (GRCm39) E20* probably null Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Tmem26 T C 10: 68,559,884 (GRCm39) L52P probably damaging Het
Utp3 T C 5: 88,703,823 (GRCm39) Y451H probably damaging Het
Zbtb39 T A 10: 127,579,505 (GRCm39) I693N probably damaging Het
Zfp174 A G 16: 3,665,921 (GRCm39) E62G probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGACACTCCGATTGTAAAGGC -3'
(R):5'- AACAGCTGAGCCCTTATTGC -3'

Sequencing Primer
(F):5'- GGCAAATAATCGAGCTCTCAGTTAC -3'
(R):5'- GCTGAGCCCTTATTGCACAAAATG -3'
Posted On 2018-07-24