Incidental Mutation 'R6710:Tap1'
ID529108
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Nametransporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
MMRRC Submission
Accession Numbers

Genbank: NM_013683; MGI: 98483

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6710 (G1)
Quality Score140.008
Status Not validated
Chromosome17
Chromosomal Location34187553-34197225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34188109 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 77 (A77V)
Ref Sequence ENSEMBL: ENSMUSP00000128401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000171321] [ENSMUST00000173831] [ENSMUST00000174576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041633
AA Change: A77V

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: A77V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect possibly damaging
Transcript: ENSMUST00000170086
AA Change: A77V

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: A77V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171148
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171321
Predicted Effect probably benign
Transcript: ENSMUST00000173831
SMART Domains Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 1 64 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174576
SMART Domains Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 17 198 1.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179593
Meta Mutation Damage Score 0.0881 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,226,061 E124D probably benign Het
Aph1c T C 9: 66,834,520 T27A probably benign Het
Ash2l T C 8: 25,819,712 I507V possibly damaging Het
Cela2a C A 4: 141,822,243 A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Drc1 A G 5: 30,363,085 D590G possibly damaging Het
Epn1 A G 7: 5,097,304 E472G probably damaging Het
Erfe A G 1: 91,372,406 D318G probably damaging Het
Ifnar2 T C 16: 91,393,883 C227R probably damaging Het
March11 A G 15: 26,387,863 Y268C probably damaging Het
Muc16 A T 9: 18,642,070 I4309N possibly damaging Het
Nit2 A G 16: 57,160,130 V95A possibly damaging Het
Nup205 T G 6: 35,247,373 I2049S probably benign Het
Olfr869 C T 9: 20,138,082 A322V probably benign Het
Olfr91 T G 17: 37,093,746 I43L probably damaging Het
Pcdhb17 T C 18: 37,485,399 S81P probably damaging Het
Plcg2 A G 8: 117,557,347 I128V probably benign Het
Sem1 C A 6: 6,578,497 E20* probably null Het
Tmem26 T C 10: 68,724,054 L52P probably damaging Het
Utp3 T C 5: 88,555,964 Y451H probably damaging Het
Vmn2r103 T A 17: 19,811,977 I671N probably damaging Het
Zbtb39 T A 10: 127,743,636 I693N probably damaging Het
Zfp174 A G 16: 3,848,057 E62G probably damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
joplin UTSW 17 34193258 missense probably damaging 1.00
ragtime UTSW 17 34190642 nonsense probably null
rose2 UTSW 17 34194941 missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34193191 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1795:Tap1 UTSW 17 34194925 missense probably benign 0.21
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 unclassified probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3883:Tap1 UTSW 17 34193258 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4418:Tap1 UTSW 17 34188379 unclassified probably null
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
R7437:Tap1 UTSW 17 34190642 nonsense probably null
R7514:Tap1 UTSW 17 34196665 missense probably damaging 1.00
R7618:Tap1 UTSW 17 34188238 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTCTAGTCAGCTCCACCAG -3'
(R):5'- AGACGTCTCTTCTTAGGGCC -3'

Sequencing Primer
(F):5'- AGACTCTGGACAGCTCACG -3'
(R):5'- TCTCTTCTTAGGGCCCAGGAAG -3'
Posted On2018-07-24