Incidental Mutation 'R6711:Mme'
ID529118
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6711 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63341918 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 289 (K289N)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029400
AA Change: K289N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: K289N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect possibly damaging
Transcript: ENSMUST00000194134
AA Change: K289N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: K289N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194150
AA Change: K289N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: K289N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c21 A G 13: 4,577,375 D156G probably damaging Het
Ankrd35 C T 3: 96,683,468 Q357* probably null Het
Ano2 G A 6: 125,775,832 A191T probably damaging Het
Cacna2d1 C T 5: 16,300,041 T331I probably damaging Het
Ccdc81 T G 7: 89,887,798 E214A probably damaging Het
Cdh4 A G 2: 179,890,931 T729A probably damaging Het
Ceacam2 A G 7: 25,538,870 L43P probably benign Het
Ces2h A T 8: 105,018,083 R364S probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Epb42 T A 2: 121,024,108 probably benign Het
Fam189a2 T C 19: 23,978,099 N385S probably benign Het
Fcgbp G A 7: 28,089,673 V555M probably damaging Het
Ganc A T 2: 120,450,839 H723L possibly damaging Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Glrb A G 3: 80,844,974 I443T probably benign Het
Hcfc1 A T X: 73,950,065 C1165S probably damaging Homo
Hoxd10 A G 2: 74,694,163 Y273C probably damaging Het
Iba57 T C 11: 59,158,543 T267A probably damaging Het
Impg2 C A 16: 56,265,086 P943H probably damaging Het
Kidins220 A G 12: 24,998,751 T145A probably damaging Het
Lmntd1 T C 6: 145,543,502 Y11C probably benign Het
Lyst A T 13: 13,635,235 T497S possibly damaging Het
Man1a G A 10: 53,933,492 H406Y probably benign Het
Mrps21 G A 3: 95,870,583 probably benign Het
Mtor A G 4: 148,452,367 N33D possibly damaging Het
Ncoa1 C A 12: 4,322,904 A166S probably benign Het
Ndrg2 A T 14: 51,910,325 F112I possibly damaging Het
Neb A C 2: 52,223,064 F36C probably benign Het
Neb A G 2: 52,256,287 Y2893H probably damaging Het
Olfr936 A G 9: 39,046,866 *229Q probably null Het
Pcdh15 A T 10: 74,642,387 E231D possibly damaging Het
Pih1d2 T A 9: 50,618,010 M1K probably null Het
Pla2g4e T C 2: 120,171,270 N633D probably benign Het
Rph3al C A 11: 75,908,984 G50* probably null Het
Rtcb A T 10: 85,939,099 N477K possibly damaging Het
Scn10a A G 9: 119,609,913 F1630S probably damaging Het
Srfbp1 T C 18: 52,488,301 S145P probably damaging Het
St7 A G 6: 17,848,070 E211G possibly damaging Het
Thbs2 T C 17: 14,690,265 D24G probably benign Het
Tlr6 C A 5: 64,954,492 M357I probably damaging Het
Tmem168 T C 6: 13,603,121 Y82C probably damaging Het
Tnrc18 A T 5: 142,787,790 L245Q unknown Het
Vmn1r8 T C 6: 57,036,459 L165P probably damaging Het
Vps13b A G 15: 35,887,249 Y3268C probably damaging Het
Zdhhc7 A G 8: 120,083,327 I218T probably benign Het
Zfp213 A G 17: 23,559,511 F209S probably benign Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
R7783:Mme UTSW 3 63364867 missense probably damaging 1.00
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGGCTTGGACCGTTAC -3'
(R):5'- CGAATGATGAGTGTCATTAGCATTCAC -3'

Sequencing Primer
(F):5'- TTGGACCGTTACCAAGAAGTTAAAAG -3'
(R):5'- CTATCAGGGAAGGGTATAGG -3'
Posted On2018-07-24