Incidental Mutation 'R6711:Tlr6'
ID529124
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6711 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64954492 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 357 (M357I)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably damaging
Transcript: ENSMUST00000062315
AA Change: M357I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: M357I

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c21 A G 13: 4,577,375 D156G probably damaging Het
Ankrd35 C T 3: 96,683,468 Q357* probably null Het
Ano2 G A 6: 125,775,832 A191T probably damaging Het
Cacna2d1 C T 5: 16,300,041 T331I probably damaging Het
Ccdc81 T G 7: 89,887,798 E214A probably damaging Het
Cdh4 A G 2: 179,890,931 T729A probably damaging Het
Ceacam2 A G 7: 25,538,870 L43P probably benign Het
Ces2h A T 8: 105,018,083 R364S probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Epb42 T A 2: 121,024,108 probably benign Het
Fam189a2 T C 19: 23,978,099 N385S probably benign Het
Fcgbp G A 7: 28,089,673 V555M probably damaging Het
Ganc A T 2: 120,450,839 H723L possibly damaging Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Glrb A G 3: 80,844,974 I443T probably benign Het
Hcfc1 A T X: 73,950,065 C1165S probably damaging Homo
Hoxd10 A G 2: 74,694,163 Y273C probably damaging Het
Iba57 T C 11: 59,158,543 T267A probably damaging Het
Impg2 C A 16: 56,265,086 P943H probably damaging Het
Kidins220 A G 12: 24,998,751 T145A probably damaging Het
Lmntd1 T C 6: 145,543,502 Y11C probably benign Het
Lyst A T 13: 13,635,235 T497S possibly damaging Het
Man1a G A 10: 53,933,492 H406Y probably benign Het
Mme A T 3: 63,341,918 K289N possibly damaging Het
Mrps21 G A 3: 95,870,583 probably benign Het
Mtor A G 4: 148,452,367 N33D possibly damaging Het
Ncoa1 C A 12: 4,322,904 A166S probably benign Het
Ndrg2 A T 14: 51,910,325 F112I possibly damaging Het
Neb A C 2: 52,223,064 F36C probably benign Het
Neb A G 2: 52,256,287 Y2893H probably damaging Het
Olfr936 A G 9: 39,046,866 *229Q probably null Het
Pcdh15 A T 10: 74,642,387 E231D possibly damaging Het
Pih1d2 T A 9: 50,618,010 M1K probably null Het
Pla2g4e T C 2: 120,171,270 N633D probably benign Het
Rph3al C A 11: 75,908,984 G50* probably null Het
Rtcb A T 10: 85,939,099 N477K possibly damaging Het
Scn10a A G 9: 119,609,913 F1630S probably damaging Het
Srfbp1 T C 18: 52,488,301 S145P probably damaging Het
St7 A G 6: 17,848,070 E211G possibly damaging Het
Thbs2 T C 17: 14,690,265 D24G probably benign Het
Tmem168 T C 6: 13,603,121 Y82C probably damaging Het
Tnrc18 A T 5: 142,787,790 L245Q unknown Het
Vmn1r8 T C 6: 57,036,459 L165P probably damaging Het
Vps13b A G 15: 35,887,249 Y3268C probably damaging Het
Zdhhc7 A G 8: 120,083,327 I218T probably benign Het
Zfp213 A G 17: 23,559,511 F209S probably benign Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATCCAAAGTTTCCAGAGAGG -3'
(R):5'- CCTGGAAGTGCTCGGTTAAAC -3'

Sequencing Primer
(F):5'- GAGGACATATTCTTAGTCATGAGAGC -3'
(R):5'- GAAGTGCTCGGTTAAACTTTTCC -3'
Posted On2018-07-24