Incidental Mutation 'R6711:Tnrc18'
ID 529125
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Name trinucleotide repeat containing 18
Synonyms Zfp469, EG381742
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock # R6711 (G1)
Quality Score 192.009
Status Validated
Chromosome 5
Chromosomal Location 142724661-142817662 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 142787790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 245 (L245Q)
Ref Sequence ENSEMBL: ENSMUSP00000117651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000151477
AA Change: L428Q
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: L428Q

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: L245Q
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: L245Q

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155461
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c21 A G 13: 4,577,375 D156G probably damaging Het
Ankrd35 C T 3: 96,683,468 Q357* probably null Het
Ano2 G A 6: 125,775,832 A191T probably damaging Het
Cacna2d1 C T 5: 16,300,041 T331I probably damaging Het
Ccdc81 T G 7: 89,887,798 E214A probably damaging Het
Cdh4 A G 2: 179,890,931 T729A probably damaging Het
Ceacam2 A G 7: 25,538,870 L43P probably benign Het
Ces2h A T 8: 105,018,083 R364S probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Epb42 T A 2: 121,024,108 probably benign Het
Fam189a2 T C 19: 23,978,099 N385S probably benign Het
Fcgbp G A 7: 28,089,673 V555M probably damaging Het
Ganc A T 2: 120,450,839 H723L possibly damaging Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Glrb A G 3: 80,844,974 I443T probably benign Het
Hcfc1 A T X: 73,950,065 C1165S probably damaging Homo
Hoxd10 A G 2: 74,694,163 Y273C probably damaging Het
Iba57 T C 11: 59,158,543 T267A probably damaging Het
Impg2 C A 16: 56,265,086 P943H probably damaging Het
Kidins220 A G 12: 24,998,751 T145A probably damaging Het
Lmntd1 T C 6: 145,543,502 Y11C probably benign Het
Lyst A T 13: 13,635,235 T497S possibly damaging Het
Man1a G A 10: 53,933,492 H406Y probably benign Het
Mme A T 3: 63,341,918 K289N possibly damaging Het
Mrps21 G A 3: 95,870,583 probably benign Het
Mtor A G 4: 148,452,367 N33D possibly damaging Het
Ncoa1 C A 12: 4,322,904 A166S probably benign Het
Ndrg2 A T 14: 51,910,325 F112I possibly damaging Het
Neb A G 2: 52,256,287 Y2893H probably damaging Het
Neb A C 2: 52,223,064 F36C probably benign Het
Olfr936 A G 9: 39,046,866 *229Q probably null Het
Pcdh15 A T 10: 74,642,387 E231D possibly damaging Het
Pih1d2 T A 9: 50,618,010 M1K probably null Het
Pla2g4e T C 2: 120,171,270 N633D probably benign Het
Rph3al C A 11: 75,908,984 G50* probably null Het
Rtcb A T 10: 85,939,099 N477K possibly damaging Het
Scn10a A G 9: 119,609,913 F1630S probably damaging Het
Srfbp1 T C 18: 52,488,301 S145P probably damaging Het
St7 A G 6: 17,848,070 E211G possibly damaging Het
Thbs2 T C 17: 14,690,265 D24G probably benign Het
Tlr6 C A 5: 64,954,492 M357I probably damaging Het
Tmem168 T C 6: 13,603,121 Y82C probably damaging Het
Vmn1r8 T C 6: 57,036,459 L165P probably damaging Het
Vps13b A G 15: 35,887,249 Y3268C probably damaging Het
Zdhhc7 A G 8: 120,083,327 I218T probably benign Het
Zfp213 A G 17: 23,559,511 F209S probably benign Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
R8745:Tnrc18 UTSW 5 142787447 missense
R8837:Tnrc18 UTSW 5 142793056 missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142739457 missense unknown
R8909:Tnrc18 UTSW 5 142776376 missense
R9030:Tnrc18 UTSW 5 142726063 missense probably damaging 1.00
R9186:Tnrc18 UTSW 5 142787733 missense
R9189:Tnrc18 UTSW 5 142731352 missense probably damaging 1.00
R9192:Tnrc18 UTSW 5 142787847 missense
R9227:Tnrc18 UTSW 5 142787637 missense
R9230:Tnrc18 UTSW 5 142787637 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TGTATTTGATGAGGCTCTGCATAGC -3'
(R):5'- GGAGAAAAGCTCGGTCATCC -3'

Sequencing Primer
(F):5'- TGCATAGCAGAGGCCTCTC -3'
(R):5'- GGTCATCCGCTCCCTCAAG -3'
Posted On 2018-07-24