Incidental Mutation 'R6711:Thbs2'
ID529151
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6711 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14690265 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 24 (D24G)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: D24G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: D24G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c21 A G 13: 4,577,375 D156G probably damaging Het
Ankrd35 C T 3: 96,683,468 Q357* probably null Het
Ano2 G A 6: 125,775,832 A191T probably damaging Het
Cacna2d1 C T 5: 16,300,041 T331I probably damaging Het
Ccdc81 T G 7: 89,887,798 E214A probably damaging Het
Cdh4 A G 2: 179,890,931 T729A probably damaging Het
Ceacam2 A G 7: 25,538,870 L43P probably benign Het
Ces2h A T 8: 105,018,083 R364S probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Epb42 T A 2: 121,024,108 probably benign Het
Fam189a2 T C 19: 23,978,099 N385S probably benign Het
Fcgbp G A 7: 28,089,673 V555M probably damaging Het
Ganc A T 2: 120,450,839 H723L possibly damaging Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Glrb A G 3: 80,844,974 I443T probably benign Het
Hcfc1 A T X: 73,950,065 C1165S probably damaging Homo
Hoxd10 A G 2: 74,694,163 Y273C probably damaging Het
Iba57 T C 11: 59,158,543 T267A probably damaging Het
Impg2 C A 16: 56,265,086 P943H probably damaging Het
Kidins220 A G 12: 24,998,751 T145A probably damaging Het
Lmntd1 T C 6: 145,543,502 Y11C probably benign Het
Lyst A T 13: 13,635,235 T497S possibly damaging Het
Man1a G A 10: 53,933,492 H406Y probably benign Het
Mme A T 3: 63,341,918 K289N possibly damaging Het
Mrps21 G A 3: 95,870,583 probably benign Het
Mtor A G 4: 148,452,367 N33D possibly damaging Het
Ncoa1 C A 12: 4,322,904 A166S probably benign Het
Ndrg2 A T 14: 51,910,325 F112I possibly damaging Het
Neb A C 2: 52,223,064 F36C probably benign Het
Neb A G 2: 52,256,287 Y2893H probably damaging Het
Olfr936 A G 9: 39,046,866 *229Q probably null Het
Pcdh15 A T 10: 74,642,387 E231D possibly damaging Het
Pih1d2 T A 9: 50,618,010 M1K probably null Het
Pla2g4e T C 2: 120,171,270 N633D probably benign Het
Rph3al C A 11: 75,908,984 G50* probably null Het
Rtcb A T 10: 85,939,099 N477K possibly damaging Het
Scn10a A G 9: 119,609,913 F1630S probably damaging Het
Srfbp1 T C 18: 52,488,301 S145P probably damaging Het
St7 A G 6: 17,848,070 E211G possibly damaging Het
Tlr6 C A 5: 64,954,492 M357I probably damaging Het
Tmem168 T C 6: 13,603,121 Y82C probably damaging Het
Tnrc18 A T 5: 142,787,790 L245Q unknown Het
Vmn1r8 T C 6: 57,036,459 L165P probably damaging Het
Vps13b A G 15: 35,887,249 Y3268C probably damaging Het
Zdhhc7 A G 8: 120,083,327 I218T probably benign Het
Zfp213 A G 17: 23,559,511 F209S probably benign Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 splice site probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
R7386:Thbs2 UTSW 17 14673150 missense possibly damaging 0.95
R7621:Thbs2 UTSW 17 14674164 missense probably benign
R7747:Thbs2 UTSW 17 14670039 missense possibly damaging 0.94
R7759:Thbs2 UTSW 17 14677059 missense probably damaging 1.00
R7800:Thbs2 UTSW 17 14676296 missense probably damaging 1.00
R7895:Thbs2 UTSW 17 14676221 missense probably damaging 1.00
R8094:Thbs2 UTSW 17 14680322 missense probably benign 0.00
R8332:Thbs2 UTSW 17 14679770 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGGAAGAAGCCCTCCTTTC -3'
(R):5'- AAAGCCAGCCTCCATGATAGTG -3'

Sequencing Primer
(F):5'- CTCCTTGCAAGCTTGACAATC -3'
(R):5'- CAGCCTCCATGATAGTGGGTAG -3'
Posted On2018-07-24