Incidental Mutation 'R6711:Zfp213'
ID529152
Institutional Source Beutler Lab
Gene Symbol Zfp213
Ensembl Gene ENSMUSG00000071256
Gene Namezinc finger protein 213
SynonymsD17Ertd197e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6711 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23556769-23564226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23559511 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 209 (F209S)
Ref Sequence ENSEMBL: ENSMUSP00000093266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095606] [ENSMUST00000182769]
Predicted Effect probably benign
Transcript: ENSMUST00000095606
AA Change: F209S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093266
Gene: ENSMUSG00000071256
AA Change: F209S

DomainStartEndE-ValueType
SCAN 41 145 3.11e-56 SMART
KRAB 213 278 3.21e-4 SMART
ZnF_C2H2 326 348 3.89e-3 SMART
ZnF_C2H2 354 376 9.88e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.95e-3 SMART
ZnF_C2H2 438 460 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180920
Predicted Effect probably benign
Transcript: ENSMUST00000182769
SMART Domains Protein: ENSMUSP00000138283
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 18 175 1.7e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c21 A G 13: 4,577,375 D156G probably damaging Het
Ankrd35 C T 3: 96,683,468 Q357* probably null Het
Ano2 G A 6: 125,775,832 A191T probably damaging Het
Cacna2d1 C T 5: 16,300,041 T331I probably damaging Het
Ccdc81 T G 7: 89,887,798 E214A probably damaging Het
Cdh4 A G 2: 179,890,931 T729A probably damaging Het
Ceacam2 A G 7: 25,538,870 L43P probably benign Het
Ces2h A T 8: 105,018,083 R364S probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Epb42 T A 2: 121,024,108 probably benign Het
Fam189a2 T C 19: 23,978,099 N385S probably benign Het
Fcgbp G A 7: 28,089,673 V555M probably damaging Het
Ganc A T 2: 120,450,839 H723L possibly damaging Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Glrb A G 3: 80,844,974 I443T probably benign Het
Hcfc1 A T X: 73,950,065 C1165S probably damaging Homo
Hoxd10 A G 2: 74,694,163 Y273C probably damaging Het
Iba57 T C 11: 59,158,543 T267A probably damaging Het
Impg2 C A 16: 56,265,086 P943H probably damaging Het
Kidins220 A G 12: 24,998,751 T145A probably damaging Het
Lmntd1 T C 6: 145,543,502 Y11C probably benign Het
Lyst A T 13: 13,635,235 T497S possibly damaging Het
Man1a G A 10: 53,933,492 H406Y probably benign Het
Mme A T 3: 63,341,918 K289N possibly damaging Het
Mrps21 G A 3: 95,870,583 probably benign Het
Mtor A G 4: 148,452,367 N33D possibly damaging Het
Ncoa1 C A 12: 4,322,904 A166S probably benign Het
Ndrg2 A T 14: 51,910,325 F112I possibly damaging Het
Neb A C 2: 52,223,064 F36C probably benign Het
Neb A G 2: 52,256,287 Y2893H probably damaging Het
Olfr936 A G 9: 39,046,866 *229Q probably null Het
Pcdh15 A T 10: 74,642,387 E231D possibly damaging Het
Pih1d2 T A 9: 50,618,010 M1K probably null Het
Pla2g4e T C 2: 120,171,270 N633D probably benign Het
Rph3al C A 11: 75,908,984 G50* probably null Het
Rtcb A T 10: 85,939,099 N477K possibly damaging Het
Scn10a A G 9: 119,609,913 F1630S probably damaging Het
Srfbp1 T C 18: 52,488,301 S145P probably damaging Het
St7 A G 6: 17,848,070 E211G possibly damaging Het
Thbs2 T C 17: 14,690,265 D24G probably benign Het
Tlr6 C A 5: 64,954,492 M357I probably damaging Het
Tmem168 T C 6: 13,603,121 Y82C probably damaging Het
Tnrc18 A T 5: 142,787,790 L245Q unknown Het
Vmn1r8 T C 6: 57,036,459 L165P probably damaging Het
Vps13b A G 15: 35,887,249 Y3268C probably damaging Het
Zdhhc7 A G 8: 120,083,327 I218T probably benign Het
Other mutations in Zfp213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp213 APN 17 23561417 missense probably benign 0.18
IGL02302:Zfp213 APN 17 23557971 missense possibly damaging 0.88
ANU18:Zfp213 UTSW 17 23561417 missense probably benign 0.18
R2137:Zfp213 UTSW 17 23559507 synonymous probably null
R4010:Zfp213 UTSW 17 23558090 missense possibly damaging 0.93
R5149:Zfp213 UTSW 17 23561399 missense probably damaging 0.97
R5595:Zfp213 UTSW 17 23561186 missense possibly damaging 0.92
R5979:Zfp213 UTSW 17 23557911 nonsense probably null
R6227:Zfp213 UTSW 17 23558022 missense probably benign 0.16
R7105:Zfp213 UTSW 17 23558204 missense probably benign 0.40
R7409:Zfp213 UTSW 17 23559629 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGGGAAGGGCTAGCTTTAG -3'
(R):5'- TCCCTGTTCTTAAAGAGCGAC -3'

Sequencing Primer
(F):5'- GGCTAGCTTTAGAACCTGACCAG -3'
(R):5'- CCTGTTCTTAAAGAGCGACAGACAG -3'
Posted On2018-07-24