Incidental Mutation 'R6712:Foxn1'
ID529175
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6712 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78361259 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 382 (D382A)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect probably damaging
Transcript: ENSMUST00000108294
AA Change: D382A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: D382A

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,332,888 T443M probably damaging Het
Ankmy1 A T 1: 92,870,922 V950D probably damaging Het
Cep350 T C 1: 155,858,106 K3014E possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dmxl2 A G 9: 54,411,624 Y1586H probably damaging Het
Dnah11 A T 12: 118,050,722 I2010N probably damaging Het
Dock10 T A 1: 80,536,866 M1446L probably benign Het
E430018J23Rik A T 7: 127,392,310 H168Q probably damaging Het
Fcmr T C 1: 130,877,851 L274P probably damaging Het
Gpr179 T C 11: 97,336,167 R1721G possibly damaging Het
H2afj A G 6: 136,808,526 I63V probably benign Het
Mfsd9 T C 1: 40,786,441 probably null Het
Mis18a T C 16: 90,727,157 E39G possibly damaging Het
Mmp27 A T 9: 7,572,176 T126S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myo5a A C 9: 75,212,900 D1635A probably benign Het
Ngdn T C 14: 55,016,188 V11A probably benign Het
Nlrc4 A T 17: 74,446,836 M184K probably damaging Het
Olfr63 T G 17: 33,269,268 H181Q possibly damaging Het
Olfr672 A T 7: 104,996,418 I162K possibly damaging Het
Peli2 C A 14: 48,250,594 Q81K probably benign Het
Pfdn2 T A 1: 171,357,851 I97K probably damaging Het
Pknox1 C A 17: 31,595,316 T205K probably benign Het
Polh T C 17: 46,190,729 S179G probably benign Het
Ppp4r4 G A 12: 103,596,443 R557Q probably damaging Het
Sipa1 A T 19: 5,660,819 D54E possibly damaging Het
Tmc8 C A 11: 117,784,813 N185K probably benign Het
Tns1 C A 1: 74,079,301 E57* probably null Het
Tyro3 G A 2: 119,804,854 A209T probably null Het
Ube2f T A 1: 91,276,449 C116S possibly damaging Het
Vmn1r231 T C 17: 20,889,730 T308A possibly damaging Het
Wwc2 T A 8: 47,900,803 M99L probably benign Het
Zfp516 C T 18: 82,957,308 R544C probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
R8838:Foxn1 UTSW 11 78361612 missense possibly damaging 0.52
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAAGATGCCCATCTGG -3'
(R):5'- AAACCAGGTGAGGCTGTCAG -3'

Sequencing Primer
(F):5'- CCATCTGGCTGTGGGAACAATG -3'
(R):5'- CTGTCAGGCCTGTGTGAGAAAG -3'
Posted On2018-07-24